EMAIL THIS PAGE TO A FRIEND

ACTN1

actinin, alpha 1

91 Gene Product Result for
Synonyms: BDPLT15
UniProtKB ID: P12814, B3V8S3, B4DHH3, Q1HE25, Q9BTN1
Gene ID:
Human(87) Summary: Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(109711) actinin, alpha 1
Rat(81634) actinin, alpha 1
Zebrafish(560400) actinin, alpha 1
cow(524770) actinin, alpha 1
domestic cat(101097986) actinin, alpha 1
dog(480369) actinin, alpha 1
chicken(373918) actinin, alpha 1
naked mole-rat(101711839) actinin, alpha 1
sheep(101122194) actinin, alpha 1
Domestic Rabbit(100341378) actinin, alpha 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701860 Anti-actn1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2701760 Anti-actn1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA006035 Anti-ACTN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB2100038 Anti-ACTN1 antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig, rabbit, mouse, bovine, zebrafish, rat, horse, canine
western blot pricing
SAB1411555 Anti-ACTN1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB4503221 Anti-ACTN1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB3300072 Monoclonal Anti-α-Actinin antibody produced in mouse clone 7A4, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
A5044 Monoclonal Anti-α-Actinin antibody produced in mouse clone BM-75.2, ascites fluid mouse, bovine, human, chicken
immunofluorescence, microarray, western blot pricing
WH0000087M1 Monoclonal Anti-ACTN1 antibody produced in mouse clone 3F1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102 Rosetta Predictions human pricing
NM_031005 Rosetta Predictions rat pricing
NM_134156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061382 predicted 1891
2 SASI_Hs01_00061383 predicted 2640
3 SASI_Hs01_00061384 predicted 1908
4 SASI_Hs01_00061385 predicted 442
5 SASI_Hs01_00061386 predicted 2597
6 SASI_Hs01_00061387 predicted 2078
7 SASI_Hs01_00061388 predicted 1690
8 SASI_Hs01_00061389 predicted 774
9 SASI_Hs01_00061390 predicted 2617
10 SASI_Hs01_00061391 predicted 2081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037086 predicted 1615
2 SASI_Rn01_00037087 predicted 764
3 SASI_Rn01_00037088 predicted 825
4 SASI_Rn01_00037089 predicted 2158
5 SASI_Rn01_00037090 predicted 1325
6 SASI_Rn01_00037091 predicted 1583
7 SASI_Rn01_00037092 predicted 470
8 SASI_Rn01_00037094 predicted 840
9 SASI_Rn01_00037095 predicted 1596
10 SASI_Rn02_00264193 predicted 2626
11 SASI_Rn01_00037093 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339421 predicted 2118
2 SASI_Mm01_00055866 predicted 1502
3 SASI_Mm01_00055867 predicted 2176
4 SASI_Mm01_00055868 predicted 985
5 SASI_Mm01_00055869 predicted 1013
6 SASI_Mm01_00055870 predicted 2096
7 SASI_Mm01_00055871 predicted 1945
8 SASI_Mm01_00055872 predicted 2584
9 SASI_Mm01_00055873 predicted 1635
10 SASI_Mm01_00055874 predicted 1920
11 SASI_Mm01_00055875 predicted 2670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134156
VALIDATED
ACTN1 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-3071s1c1
Sequence:CCGGCCACAAAGTGACAGTTTACAACTCGAGTTGTAAACTGTCACTTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2602s1c1
Sequence:CCGGGCCCGAATCATGAGCATTGTACTCGAGTACAATGCTCATGATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-788s1c1
Sequence:CCGGCCGAGTTGATTGACTATGGAACTCGAGTTCCATAGTCAATCAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2457s1c1
Sequence:CCGGCCAGGAACAGATGAACGAATTCTCGAGAATTCGTTCATCTGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2255s1c1
Sequence:CCGGGCATCGTCAATTACAAGCCAACTCGAGTTGGCTTGTAATTGACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134156
VALIDATED
ACTN1 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-3071s1c1
Sequence:CCGGCCACAAAGTGACAGTTTACAACTCGAGTTGTAAACTGTCACTTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2602s1c1
Sequence:CCGGGCCCGAATCATGAGCATTGTACTCGAGTACAATGCTCATGATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-788s1c1
Sequence:CCGGCCGAGTTGATTGACTATGGAACTCGAGTTCCATAGTCAATCAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2457s1c1
Sequence:CCGGCCAGGAACAGATGAACGAATTCTCGAGAATTCGTTCATCTGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2255s1c1
Sequence:CCGGGCATCGTCAATTACAAGCCAACTCGAGTTGGCTTGTAATTGACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134156
VALIDATED
ACTN1 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-3071s1c1
Sequence:CCGGCCACAAAGTGACAGTTTACAACTCGAGTTGTAAACTGTCACTTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2602s1c1
Sequence:CCGGGCCCGAATCATGAGCATTGTACTCGAGTACAATGCTCATGATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-788s1c1
Sequence:CCGGCCGAGTTGATTGACTATGGAACTCGAGTTCCATAGTCAATCAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2457s1c1
Sequence:CCGGCCAGGAACAGATGAACGAATTCTCGAGAATTCGTTCATCTGTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134156.1-2255s1c1
Sequence:CCGGGCATCGTCAATTACAAGCCAACTCGAGTTGGCTTGTAATTGACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102
ACTN1 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-2213s1c1
Sequence:CCGGGCATCGTCAACTACAAGCCAACTCGAGTTGGCTTGTAGTTGACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-1920s1c1
Sequence:CCGGCCAGACCTACCACGTCAATATCTCGAGATATTGACGTGGTAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-893s1c1
Sequence:CCGGCCATCATGACTTACGTGTCTACTCGAGTAGACACGTAAGTCATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-519s1c1
Sequence:CCGGCGAAGAAATCGTGGATGGGAACTCGAGTTCCCATCCACGATTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-1972s1c1
Sequence:CCGGCCTCAGGAGATCAATGGCAAACTCGAGTTTGCCATTGATCTCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2046s21c1
Sequence:CCGGTCCAGACCTACCACGTCAATACTCGAGTATTGACGTGGTAGGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102.3-3267s21c1
Sequence:CCGGATTAACTATTTGCACCGAAATCTCGAGATTTCGGTGCAAATAGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2094s21c1
Sequence:CCGGTCACGCCTCAGGAGATCAATGCTCGAGCATTGATCTCCTGAGGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-1691s21c1
Sequence:CCGGCTCAATGAGCTGGACTATTATCTCGAGATAATAGTCCAGCTCATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2970s21c1
Sequence:CCGGACGGCGAGAGTGACCTCTAATCTCGAGATTAGAGGTCACTCTCGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102
ACTN1 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-2213s1c1
Sequence:CCGGGCATCGTCAACTACAAGCCAACTCGAGTTGGCTTGTAGTTGACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-1920s1c1
Sequence:CCGGCCAGACCTACCACGTCAATATCTCGAGATATTGACGTGGTAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-893s1c1
Sequence:CCGGCCATCATGACTTACGTGTCTACTCGAGTAGACACGTAAGTCATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-519s1c1
Sequence:CCGGCGAAGAAATCGTGGATGGGAACTCGAGTTCCCATCCACGATTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-1972s1c1
Sequence:CCGGCCTCAGGAGATCAATGGCAAACTCGAGTTTGCCATTGATCTCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2046s21c1
Sequence:CCGGTCCAGACCTACCACGTCAATACTCGAGTATTGACGTGGTAGGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102.3-3267s21c1
Sequence:CCGGATTAACTATTTGCACCGAAATCTCGAGATTTCGGTGCAAATAGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2094s21c1
Sequence:CCGGTCACGCCTCAGGAGATCAATGCTCGAGCATTGATCTCCTGAGGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-1691s21c1
Sequence:CCGGCTCAATGAGCTGGACTATTATCTCGAGATAATAGTCCAGCTCATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2970s21c1
Sequence:CCGGACGGCGAGAGTGACCTCTAATCTCGAGATTAGAGGTCACTCTCGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102
ACTN1 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-2213s1c1
Sequence:CCGGGCATCGTCAACTACAAGCCAACTCGAGTTGGCTTGTAGTTGACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-1920s1c1
Sequence:CCGGCCAGACCTACCACGTCAATATCTCGAGATATTGACGTGGTAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-893s1c1
Sequence:CCGGCCATCATGACTTACGTGTCTACTCGAGTAGACACGTAAGTCATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-519s1c1
Sequence:CCGGCGAAGAAATCGTGGATGGGAACTCGAGTTCCCATCCACGATTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001102.2-1972s1c1
Sequence:CCGGCCTCAGGAGATCAATGGCAAACTCGAGTTTGCCATTGATCTCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2046s21c1
Sequence:CCGGTCCAGACCTACCACGTCAATACTCGAGTATTGACGTGGTAGGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102.3-3267s21c1
Sequence:CCGGATTAACTATTTGCACCGAAATCTCGAGATTTCGGTGCAAATAGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2094s21c1
Sequence:CCGGTCACGCCTCAGGAGATCAATGCTCGAGCATTGATCTCCTGAGGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-1691s21c1
Sequence:CCGGCTCAATGAGCTGGACTATTATCTCGAGATAATAGTCCAGCTCATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102.3-2970s21c1
Sequence:CCGGACGGCGAGAGTGACCTCTAATCTCGAGATTAGAGGTCACTCTCGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)