EMAIL THIS PAGE TO A FRIEND

ACTN2

actinin, alpha 2

87 Gene Product Result for
Synonyms: CMD1AA
UniProtKB ID: P35609, B1ANE4, Q86TF4, Q86TI8
Gene ID:
Human(88) Summary: Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Mouse(11472) actinin alpha 2
Rat(291245) actinin alpha 2
Zebrafish(641575) actinin, alpha 2
domestic cat(101101415) actinin, alpha 2
cow(536607) actinin, alpha 2
Horse(100033870) actinin, alpha 2
dog(479191) actinin, alpha 2
chicken(396263) actinin, alpha 2
sheep(101116372) actinin, alpha 2
Domestic Rabbit(100350274) actinin, alpha 2
naked mole-rat(101721630) actinin, alpha 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A7732 Anti-α-Actinin (Sarcomeric) antibody, Mouse monoclonal clone EA-53, purified from hybridoma cell culture rabbit, human, mouse, pig, bovine, rat, snake, cat, canine, frog, fish, goat, sheep, chicken, hamster, lizard
immunohistochemistry, western blot pricing
A2543 Anti-α-Actinin antibody produced in rabbit whole antiserum chicken
immunofluorescence, western blot pricing
SAB4503474 Anti-Actinin α, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108642 Anti-ACTN2 affinity isolated antibody human, horse, guinea pig, bovine, rat, canine, bovine, rabbit
immunohistochemistry, western blot pricing
AV37422 Anti-ACTN2 (AB1) antibody produced in rabbit IgG fraction of antiserum human, guinea pig, mouse, horse, canine, rabbit, bovine, rat, zebrafish,
western blot pricing
AV41463 Anti-ACTN2 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, human, horse, zebrafish, guinea pig, rabbit, mouse, rat, canine
immunohistochemistry, western blot pricing
SAB2701702 Anti-actn2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701762 Anti-actn2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA008315 Anti-ACTN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2100039 Anti-ACTN2 antibody produced in rabbit affinity isolated antibody rabbit, human, bovine, rat, canine, horse, mouse, guinea pig
western blot pricing
A7811 Monoclonal Anti-α-Actinin (Sarcomeric) antibody produced in mouse clone EA-53, ascites fluid sheep, rabbit, lizard, feline, canine, snake, human, fish, goat, mouse, chicken, rat, bovine, frog, pig, hamster
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103 Rosetta Predictions human pricing
XM_001061664 Rosetta Predictions rat pricing
XM_214499 Rosetta Predictions rat pricing
NM_033268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201531 predicted 1031
2 SASI_Hs01_00201532 predicted 2339
3 SASI_Hs01_00201534 predicted 2588
4 SASI_Hs01_00201535 predicted 696
5 SASI_Hs01_00201536 predicted 2422
6 SASI_Hs02_00323532 predicted 1633
7 SASI_Hs01_00201537 predicted 1297
8 SASI_Hs01_00201538 predicted 1801
9 SASI_Hs01_00201539 predicted 1732
10 SASI_Hs01_00201540 predicted 341
11 SASI_Hs01_00201533 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300925 predicted 1520
2 SASI_Rn02_00300926 predicted 534
3 SASI_Rn02_00300927 predicted 1439
4 SASI_Rn02_00300928 predicted 640
5 SASI_Rn02_00300929 predicted 1671
6 SASI_Rn02_00300930 predicted 828
7 SASI_Rn02_00300931 predicted 858
8 SASI_Rn02_00300932 predicted 2636
9 SASI_Rn02_00300933 predicted 2659
10 SASI_Rn02_00300934 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375365 predicted 1516
2 SASI_Rn02_00375366 predicted 535
3 SASI_Rn02_00375367 predicted 1448
4 SASI_Rn02_00375368 predicted 646
5 SASI_Rn02_00375369 predicted 1670
6 SASI_Rn02_00375370 predicted 835
7 SASI_Rn02_00375371 predicted 854
8 SASI_Rn02_00375372 predicted 2636
9 SASI_Rn02_00375373 predicted 2660
10 SASI_Rn02_00375374 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064038 predicted 2606
2 SASI_Mm01_00064039 predicted 1389
3 SASI_Mm01_00064040 predicted 702
4 SASI_Mm01_00064041 predicted 2588
5 SASI_Mm01_00064042 predicted 1379
6 SASI_Mm01_00064043 predicted 859
7 SASI_Mm01_00064044 predicted 2148
8 SASI_Mm01_00064045 predicted 728
9 SASI_Mm01_00064046 predicted 887
10 SASI_Mm02_00337318 predicted 2493
11 SASI_Mm01_00064047 predicted 2389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001103
ACTN2 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103.2-790s21c1
Sequence:CCGGGACCTCATTGACTACTCAAAGCTCGAGCTTTGAGTAGTCAATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103.2-1298s21c1
Sequence:CCGGGCAAGATGGTGTCGGATATTGCTCGAGCAATATCCGACACCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-1690s1c1
Sequence:CCGGGAATGGAGAAATTGCTAGAAACTCGAGTTTCTAGCAATTTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-2485s1c1
Sequence:CCGGGCCTGATGGATCATGAGGATTCTCGAGAATCCTCATGATCCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-591s1c1
Sequence:CCGGCGCTTTGCTATTCAGGATATTCTCGAGAATATCCTGAATAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-215s1c1
Sequence:CCGGCGACGAGGATGAGTACATGATCTCGAGATCATGTACTCATCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-2217s1c1
Sequence:CCGGGAGCACAACATCATCAACTATCTCGAGATAGTTGATGATGTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001103
ACTN2 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103.2-790s21c1
Sequence:CCGGGACCTCATTGACTACTCAAAGCTCGAGCTTTGAGTAGTCAATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103.2-1298s21c1
Sequence:CCGGGCAAGATGGTGTCGGATATTGCTCGAGCAATATCCGACACCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-1690s1c1
Sequence:CCGGGAATGGAGAAATTGCTAGAAACTCGAGTTTCTAGCAATTTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-2485s1c1
Sequence:CCGGGCCTGATGGATCATGAGGATTCTCGAGAATCCTCATGATCCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-591s1c1
Sequence:CCGGCGCTTTGCTATTCAGGATATTCTCGAGAATATCCTGAATAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-215s1c1
Sequence:CCGGCGACGAGGATGAGTACATGATCTCGAGATCATGTACTCATCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-2217s1c1
Sequence:CCGGGAGCACAACATCATCAACTATCTCGAGATAGTTGATGATGTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001103
ACTN2 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103.2-790s21c1
Sequence:CCGGGACCTCATTGACTACTCAAAGCTCGAGCTTTGAGTAGTCAATGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103.2-1298s21c1
Sequence:CCGGGCAAGATGGTGTCGGATATTGCTCGAGCAATATCCGACACCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-1690s1c1
Sequence:CCGGGAATGGAGAAATTGCTAGAAACTCGAGTTTCTAGCAATTTCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-2485s1c1
Sequence:CCGGGCCTGATGGATCATGAGGATTCTCGAGAATCCTCATGATCCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-591s1c1
Sequence:CCGGCGCTTTGCTATTCAGGATATTCTCGAGAATATCCTGAATAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-215s1c1
Sequence:CCGGCGACGAGGATGAGTACATGATCTCGAGATCATGTACTCATCCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001103.1-2217s1c1
Sequence:CCGGGAGCACAACATCATCAACTATCTCGAGATAGTTGATGATGTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033268
ACTN2 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033268.3-2933s1c1
Sequence:CCGGCCCTACCCTATCAGAATGCAACTCGAGTTGCATTCTGATAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-1028s1c1
Sequence:CCGGGCTAACAGAATATGTAAGGTTCTCGAGAACCTTACATATTCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-509s1c1
Sequence:CCGGCGGTTCCACAAGATTGCGAATCTCGAGATTCGCAATCTTGTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-2615s1c1
Sequence:CCGGGCCCGCATTATGACTTTGGTTCTCGAGAACCAAAGTCATAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-816s1c1
Sequence:CCGGCCGACCTCATTGACTACTCAACTCGAGTTGAGTAGTCAATGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033268
ACTN2 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033268.3-2933s1c1
Sequence:CCGGCCCTACCCTATCAGAATGCAACTCGAGTTGCATTCTGATAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-1028s1c1
Sequence:CCGGGCTAACAGAATATGTAAGGTTCTCGAGAACCTTACATATTCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-509s1c1
Sequence:CCGGCGGTTCCACAAGATTGCGAATCTCGAGATTCGCAATCTTGTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-2615s1c1
Sequence:CCGGGCCCGCATTATGACTTTGGTTCTCGAGAACCAAAGTCATAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-816s1c1
Sequence:CCGGCCGACCTCATTGACTACTCAACTCGAGTTGAGTAGTCAATGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033268
ACTN2 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033268.3-2933s1c1
Sequence:CCGGCCCTACCCTATCAGAATGCAACTCGAGTTGCATTCTGATAGGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-1028s1c1
Sequence:CCGGGCTAACAGAATATGTAAGGTTCTCGAGAACCTTACATATTCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-509s1c1
Sequence:CCGGCGGTTCCACAAGATTGCGAATCTCGAGATTCGCAATCTTGTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-2615s1c1
Sequence:CCGGGCCCGCATTATGACTTTGGTTCTCGAGAACCAAAGTCATAATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033268.3-816s1c1
Sequence:CCGGCCGACCTCATTGACTACTCAACTCGAGTTGAGTAGTCAATGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks