EMAIL THIS PAGE TO A FRIEND

ACTN3

actinin, alpha 3

46 Gene Product Result for
UniProtKB ID: Q08043, A6NP77, Q4KKV2
Gene ID:
Human(89) Summary: This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. An allelic polymorphism in this gene results in both coding and non-coding variants. The reference genome contains the non-coding allele. The non-functional allele of this gene is associated with elite athlete status. [provided by RefSeq, Apr 2012]
Mouse(11474) actinin alpha 3
Rat(171009) actinin alpha 3
naked mole-rat(101720678) actinin, alpha 3
sheep(101115917) actinin, alpha 3
Domestic Rabbit(100009544) actinin, alpha 3
fruit fly(44964) alpha actinin 3
cow(539375) actinin, alpha 3
Horse(100033871) actinin, alpha 3
domestic cat(101087008) actinin, alpha 3
dog(483707) actinin, alpha 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A7732 Anti-α-Actinin (Sarcomeric) antibody, Mouse monoclonal clone EA-53, purified from hybridoma cell culture human, mouse, pig, rabbit, bovine, rat, snake, frog, cat, fish, canine, goat, chicken, sheep, hamster, lizard
immunohistochemistry, western blot pricing
SAB2100040 Anti-ACTN3 antibody produced in rabbit affinity isolated antibody rat, rabbit, horse, bovine, zebrafish, rabbit, guinea pig, canine, mouse, human
western blot pricing
SAB2700830 Anti-ACTN3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB4503498 Anti-ACTN3, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001104 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104 Rosetta Predictions human pricing
NM_133424 Rosetta Predictions rat pricing
NM_013456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162019 predicted 2077
2 SASI_Hs01_00162020 predicted 2521
3 SASI_Hs01_00162021 predicted 2320
4 SASI_Hs02_00323683 predicted 1320
5 SASI_Hs01_00162023 predicted 301
6 SASI_Hs01_00162024 predicted 1784
7 SASI_Hs01_00162025 predicted 2093
8 SASI_Hs01_00162026 predicted 2344
9 SASI_Hs01_00162027 predicted 1079
10 SASI_Hs01_00162028 predicted 2257
11 SASI_Hs01_00162022 predicted 2523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097261 predicted 1153
2 SASI_Rn01_00097262 predicted 1523
3 SASI_Rn01_00097263 predicted 520
4 SASI_Rn01_00097264 predicted 1804
5 SASI_Rn01_00097266 predicted 2413
6 SASI_Rn01_00097267 predicted 479
7 SASI_Rn01_00097268 predicted 324
8 SASI_Rn01_00097269 predicted 1785
9 SASI_Rn01_00097270 predicted 2378
10 SASI_Rn02_00267682 predicted 2279
11 SASI_Rn01_00097265 predicted 1983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322051 predicted 338
2 SASI_Mm01_00053222 predicted 1143
3 SASI_Mm01_00053223 predicted 1247
4 SASI_Mm01_00053224 predicted 511
5 SASI_Mm01_00053225 predicted 1848
6 SASI_Mm01_00053226 predicted 1790
7 SASI_Mm01_00053227 predicted 2400
8 SASI_Mm01_00053228 predicted 314
9 SASI_Mm01_00053229 predicted 2262
10 SASI_Mm01_00053230 predicted 2381
11 SASI_Mm01_00053231 predicted 2469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013456
ACTN3 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-370s1c1
Sequence:CCGGGCCAGCAAAGGAGTTAAGCTACTCGAGTAGCTTAACTCCTTTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-1794s1c1
Sequence:CCGGCCAGAAGATTTGCCAAACATACTCGAGTATGTTTGGCAAATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-703s1c1
Sequence:CCGGGCAGAGAAATACCTGGACATTCTCGAGAATGTCCAGGTATTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-1627s1c1
Sequence:CCGGCCCTTCAATAACTGGCTGGATCTCGAGATCCAGCCAGTTATTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-2160s1c1
Sequence:CCGGGAGCCTAGTCTTTGACAACAACTCGAGTTGTTGTCAAAGACTAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013456
ACTN3 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-370s1c1
Sequence:CCGGGCCAGCAAAGGAGTTAAGCTACTCGAGTAGCTTAACTCCTTTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-1794s1c1
Sequence:CCGGCCAGAAGATTTGCCAAACATACTCGAGTATGTTTGGCAAATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-703s1c1
Sequence:CCGGGCAGAGAAATACCTGGACATTCTCGAGAATGTCCAGGTATTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-1627s1c1
Sequence:CCGGCCCTTCAATAACTGGCTGGATCTCGAGATCCAGCCAGTTATTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-2160s1c1
Sequence:CCGGGAGCCTAGTCTTTGACAACAACTCGAGTTGTTGTCAAAGACTAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013456
ACTN3 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-370s1c1
Sequence:CCGGGCCAGCAAAGGAGTTAAGCTACTCGAGTAGCTTAACTCCTTTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-1794s1c1
Sequence:CCGGCCAGAAGATTTGCCAAACATACTCGAGTATGTTTGGCAAATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-703s1c1
Sequence:CCGGGCAGAGAAATACCTGGACATTCTCGAGAATGTCCAGGTATTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-1627s1c1
Sequence:CCGGCCCTTCAATAACTGGCTGGATCTCGAGATCCAGCCAGTTATTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013456.1-2160s1c1
Sequence:CCGGGAGCCTAGTCTTTGACAACAACTCGAGTTGTTGTCAAAGACTAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001104
ACTN3 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-2519s1c1
Sequence:CCGGCGACTGAGCAAGTTGTAGCTTCTCGAGAAGCTACAACTTGCTCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-988s1c1
Sequence:CCGGCAGCGCAAACTAGAGGACTTTCTCGAGAAAGTCCTCTAGTTTGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-2085s1c1
Sequence:CCGGGCAGAACATTATCAACTACAACTCGAGTTGTAGTTGATAATGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-1866s1c1
Sequence:CCGGCAAGTGGGATATGGTCCGAAACTCGAGTTTCGGACCATATCCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-232s1c1
Sequence:CCGGGATTTCCGCAATGGCCTCAAACTCGAGTTTGAGGCCATTGCGGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-2330s21c1
Sequence:CCGGACTTTGACAGGAAGCGGAATGCTCGAGCATTCCGCTTCCTGTCAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-1787s21c1
Sequence:CCGGAGAAGATCTGCCAGACGTATGCTCGAGCATACGTCTGGCAGATCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-634s21c1
Sequence:CCGGGACTACGCCAAACTGCGAAAGCTCGAGCTTTCGCAGTTTGGCGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001104
ACTN3 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-2519s1c1
Sequence:CCGGCGACTGAGCAAGTTGTAGCTTCTCGAGAAGCTACAACTTGCTCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-988s1c1
Sequence:CCGGCAGCGCAAACTAGAGGACTTTCTCGAGAAAGTCCTCTAGTTTGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-2085s1c1
Sequence:CCGGGCAGAACATTATCAACTACAACTCGAGTTGTAGTTGATAATGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-1866s1c1
Sequence:CCGGCAAGTGGGATATGGTCCGAAACTCGAGTTTCGGACCATATCCCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-232s1c1
Sequence:CCGGGATTTCCGCAATGGCCTCAAACTCGAGTTTGAGGCCATTGCGGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-2330s21c1
Sequence:CCGGACTTTGACAGGAAGCGGAATGCTCGAGCATTCCGCTTCCTGTCAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-1787s21c1
Sequence:CCGGAGAAGATCTGCCAGACGTATGCTCGAGCATACGTCTGGCAGATCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-634s21c1
Sequence:CCGGGACTACGCCAAACTGCGAAAGCTCGAGCTTTCGCAGTTTGGCGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001104
ACTN3 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-2519s1c1
Sequence:CCGGCGACTGAGCAAGTTGTAGCTTCTCGAGAAGCTACAACTTGCTCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-988s1c1
Sequence:CCGGCAGCGCAAACTAGAGGACTTTCTCGAGAAAGTCCTCTAGTTTGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-2085s1c1
Sequence:CCGGGCAGAACATTATCAACTACAACTCGAGTTGTAGTTGATAATGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-1866s1c1
Sequence:CCGGCAAGTGGGATATGGTCCGAAACTCGAGTTTCGGACCATATCCCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001104.1-232s1c1
Sequence:CCGGGATTTCCGCAATGGCCTCAAACTCGAGTTTGAGGCCATTGCGGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-2330s21c1
Sequence:CCGGACTTTGACAGGAAGCGGAATGCTCGAGCATTCCGCTTCCTGTCAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-1787s21c1
Sequence:CCGGAGAAGATCTGCCAGACGTATGCTCGAGCATACGTCTGGCAGATCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001104.1-634s21c1
Sequence:CCGGGACTACGCCAAACTGCGAAAGCTCGAGCTTTCGCAGTTTGGCGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)