EMAIL THIS PAGE TO A FRIEND

ACTN4

actinin, alpha 4

89 Gene Product Result for
Synonyms: ACTININ-4 FSGS FSGS1
UniProtKB ID: O43707, O76048
Gene ID:
Human(81) Summary: Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
Mouse(60595) actinin alpha 4
Rat(63836) actinin alpha 4
Zebrafish(322221) actinin, alpha 4
cow(522269) actinin, alpha 4
domestic cat(101093978) actinin, alpha 4
dog(484526) actinin, alpha 4
chicken(396024) actinin, alpha 4
sheep(101111737) actinin, alpha 4
naked mole-rat(101710271) actinin, alpha 4
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004924 Rosetta Predictions human pricing
NM_031675 Rosetta Predictions rat pricing
XM_579522 Rosetta Predictions rat pricing
NM_021895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168720 predicted 564
2 SASI_Hs01_00168721 predicted 1715
3 SASI_Hs01_00168722 predicted 1903
4 SASI_Hs01_00168723 predicted 874
5 SASI_Hs01_00168724 predicted 391
6 SASI_Hs01_00168728 predicted 2551
7 SASI_Hs01_00168725 predicted 450
8 SASI_Hs01_00168729 predicted 2524
9 SASI_Hs01_00168726 predicted 1027
10 SASI_Hs01_00168727 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111540 predicted 1110
2 SASI_Rn02_00265018 predicted 2059
3 SASI_Rn01_00111541 predicted 1299
4 SASI_Rn01_00111542 predicted 2338
5 SASI_Rn01_00111544 predicted 771
6 SASI_Rn02_00265019 predicted 1450
7 SASI_Rn01_00111545 predicted 2529
8 SASI_Rn01_00111546 predicted 427
9 SASI_Rn01_00111547 predicted 794
10 SASI_Rn01_00111548 predicted 1788
11 SASI_Rn01_00111539 predicted 785
12 SASI_Rn01_00111543 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192326 predicted 2127
2 SASI_Rn01_00192327 predicted 2197
3 SASI_Rn01_00192328 predicted 2180
4 SASI_Rn01_00192329 predicted 2117
5 SASI_Rn01_00192330 predicted 612
6 SASI_Rn01_00192331 predicted 780
7 SASI_Rn01_00192332 predicted 1111
8 SASI_Rn01_00192333 predicted 1313
9 SASI_Rn01_00192334 predicted 2348
10 SASI_Rn01_00192335 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094633 predicted 770
2 SASI_Mm01_00094634 predicted 2483
3 SASI_Mm01_00094635 predicted 1101
4 SASI_Mm02_00326461 predicted 2670
5 SASI_Mm01_00094636 predicted 1442
6 SASI_Mm01_00094637 predicted 328
7 SASI_Mm01_00094638 predicted 766
8 SASI_Mm02_00326462 predicted 2592
9 SASI_Mm01_00094639 predicted 1599
10 SASI_Mm01_00094640 predicted 354
11 SASI_Mm01_00094641 predicted 1588
12 SASI_Mm01_00094642 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004924
VALIDATED
ACTN4 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004924.3-459s21c1
Sequence:CCGGATTGTGGACGGCAACGCAAAGCTCGAGCTTTGCGTTGCCGTCCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004924.3-395s21c1
Sequence:CCGGGAACAAAGCGCTGGACTTTATCTCGAGATAAAGTCCAGCGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004924.3-717s1c1
Sequence:CCGGCCTGTCACCAACCTGAACAATCTCGAGATTGTTCAGGTTGGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-1389s1c1
Sequence:CCGGGCCACACTATCGGACATCAAACTCGAGTTTGATGTCCGATAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004924.3-593s1c1
Sequence:CCGGCCCGTATAAGAACGTCAATGTCTCGAGACATTGACGTTCTTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-1713s1c1
Sequence:CCGGCAGGACATGTTCATCGTCCATCTCGAGATGGACGATGAACATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-2603s1c1
Sequence:CCGGCATCGCTTCCTTCAAGGTCTTCTCGAGAAGACCTTGAAGGAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004924
VALIDATED
ACTN4 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004924.3-459s21c1
Sequence:CCGGATTGTGGACGGCAACGCAAAGCTCGAGCTTTGCGTTGCCGTCCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004924.3-395s21c1
Sequence:CCGGGAACAAAGCGCTGGACTTTATCTCGAGATAAAGTCCAGCGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004924.3-717s1c1
Sequence:CCGGCCTGTCACCAACCTGAACAATCTCGAGATTGTTCAGGTTGGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-1389s1c1
Sequence:CCGGGCCACACTATCGGACATCAAACTCGAGTTTGATGTCCGATAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004924.3-593s1c1
Sequence:CCGGCCCGTATAAGAACGTCAATGTCTCGAGACATTGACGTTCTTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-1713s1c1
Sequence:CCGGCAGGACATGTTCATCGTCCATCTCGAGATGGACGATGAACATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-2603s1c1
Sequence:CCGGCATCGCTTCCTTCAAGGTCTTCTCGAGAAGACCTTGAAGGAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004924
VALIDATED
ACTN4 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004924.3-459s21c1
Sequence:CCGGATTGTGGACGGCAACGCAAAGCTCGAGCTTTGCGTTGCCGTCCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004924.3-395s21c1
Sequence:CCGGGAACAAAGCGCTGGACTTTATCTCGAGATAAAGTCCAGCGCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004924.3-717s1c1
Sequence:CCGGCCTGTCACCAACCTGAACAATCTCGAGATTGTTCAGGTTGGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-1389s1c1
Sequence:CCGGGCCACACTATCGGACATCAAACTCGAGTTTGATGTCCGATAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004924.3-593s1c1
Sequence:CCGGCCCGTATAAGAACGTCAATGTCTCGAGACATTGACGTTCTTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-1713s1c1
Sequence:CCGGCAGGACATGTTCATCGTCCATCTCGAGATGGACGATGAACATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004924.3-2603s1c1
Sequence:CCGGCATCGCTTCCTTCAAGGTCTTCTCGAGAAGACCTTGAAGGAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021895
VALIDATED
ACTN4 MISSION shRNA Bacterial Glycerol Stock
actinin, alpha 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-779s21c1
Sequence:CCGGGCATTTGAAGTGGCTGAGAAACTCGAGTTTCTCAGCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021895.2-2976s21c1
Sequence:CCGGCCTCTCTTTCTCAGTCTTGTACTCGAGTACAAGACTGAGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-418s21c1
Sequence:CCGGGCACAAGATCAACAATGTAAACTCGAGTTTACATTGTTGATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-1891s21c1
Sequence:CCGGCGCTGAGAGCAATCACATCAACTCGAGTTGATGTGATTGCTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-2589s21c1
Sequence:CCGGCCTTCATTGACTTCATGTCAACTCGAGTTGACATGAAGTCAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-2976s1c1
Sequence:CCGGCCTCTCTTTCTCAGTCTTGTACTCGAGTACAAGACTGAGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021895.2-1891s1c1
Sequence:CCGGCGCTGAGAGCAATCACATCAACTCGAGTTGATGTGATTGCTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-2589s1c1
Sequence:CCGGCCTTCATTGACTTCATGTCAACTCGAGTTGACATGAAGTCAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021895.2-779s1c1
Sequence:CCGGGCATTTGAAGTGGCTGAGAAACTCGAGTTTCTCAGCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-418s1c1
Sequence:CCGGGCACAAGATCAACAATGTAAACTCGAGTTTACATTGTTGATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021895
VALIDATED
ACTN4 MISSION shRNA shRNA Plasmid DNA
actinin, alpha 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-779s21c1
Sequence:CCGGGCATTTGAAGTGGCTGAGAAACTCGAGTTTCTCAGCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021895.2-2976s21c1
Sequence:CCGGCCTCTCTTTCTCAGTCTTGTACTCGAGTACAAGACTGAGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-418s21c1
Sequence:CCGGGCACAAGATCAACAATGTAAACTCGAGTTTACATTGTTGATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-1891s21c1
Sequence:CCGGCGCTGAGAGCAATCACATCAACTCGAGTTGATGTGATTGCTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-2589s21c1
Sequence:CCGGCCTTCATTGACTTCATGTCAACTCGAGTTGACATGAAGTCAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-2976s1c1
Sequence:CCGGCCTCTCTTTCTCAGTCTTGTACTCGAGTACAAGACTGAGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021895.2-1891s1c1
Sequence:CCGGCGCTGAGAGCAATCACATCAACTCGAGTTGATGTGATTGCTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-2589s1c1
Sequence:CCGGCCTTCATTGACTTCATGTCAACTCGAGTTGACATGAAGTCAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021895.2-779s1c1
Sequence:CCGGGCATTTGAAGTGGCTGAGAAACTCGAGTTTCTCAGCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-418s1c1
Sequence:CCGGGCACAAGATCAACAATGTAAACTCGAGTTTACATTGTTGATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021895
VALIDATED
ACTN4 MISSION shRNA Lentiviral Transduction Particles
actinin, alpha 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-779s21c1
Sequence:CCGGGCATTTGAAGTGGCTGAGAAACTCGAGTTTCTCAGCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021895.2-2976s21c1
Sequence:CCGGCCTCTCTTTCTCAGTCTTGTACTCGAGTACAAGACTGAGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-418s21c1
Sequence:CCGGGCACAAGATCAACAATGTAAACTCGAGTTTACATTGTTGATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-1891s21c1
Sequence:CCGGCGCTGAGAGCAATCACATCAACTCGAGTTGATGTGATTGCTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021895.2-2589s21c1
Sequence:CCGGCCTTCATTGACTTCATGTCAACTCGAGTTGACATGAAGTCAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-2976s1c1
Sequence:CCGGCCTCTCTTTCTCAGTCTTGTACTCGAGTACAAGACTGAGAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021895.2-1891s1c1
Sequence:CCGGCGCTGAGAGCAATCACATCAACTCGAGTTGATGTGATTGCTCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-2589s1c1
Sequence:CCGGCCTTCATTGACTTCATGTCAACTCGAGTTGACATGAAGTCAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021895.2-779s1c1
Sequence:CCGGGCATTTGAAGTGGCTGAGAAACTCGAGTTTCTCAGCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021895.2-418s1c1
Sequence:CCGGGCACAAGATCAACAATGTAAACTCGAGTTTACATTGTTGATCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks