EMAIL THIS PAGE TO A FRIEND

ACTR10

actin-related protein 10 homolog (S. cerevisiae)

79 Gene Product Result for
Synonyms: ACTR11 Arp11 HARP11
UniProtKB ID: Q9NZ32, Q9H9Y5, Q9NWY2
Gene ID:
Mouse(56444) ARP10 actin-related protein 10
Rat(299121) actin-related protein 10 homolog (S. cerevisiae)
Zebrafish(393139) actin-related protein 10 homolog (S. cerevisiae)
chicken(423543) actin-related protein 10 homolog (S. cerevisiae)
cow(511083) actin-related protein 10 homolog (S. cerevisiae)
domestic cat(101095987) actin-related protein 10 homolog (S. cerevisiae)
dog(480337) actin-related protein 10 homolog (S. cerevisiae)
naked mole-rat(101703848) actin-related protein 10 homolog (S. cerevisiae)
domestic guinea pig(100715149) actin-related protein 10 homolog (S. cerevisiae)
sheep(101115545) actin-related protein 10 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018477 Rosetta Predictions human pricing
NM_001009602 Rosetta Predictions rat pricing
NM_019785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193016 predicted 256
2 SASI_Hs01_00193023 predicted 634
3 SASI_Hs02_00352053 predicted 209
4 SASI_Hs02_00352054 predicted 1104
5 SASI_Hs02_00352055 predicted 1280
6 SASI_Hs02_00352056 predicted 953
7 SASI_Hs02_00352057 predicted 946
8 SASI_Hs02_00352058 predicted 201
9 SASI_Hs02_00352059 predicted 1384
10 SASI_Hs02_00352060 predicted 739
11 SASI_Hs01_00193015 predicted 988
12 SASI_Hs01_00193017 predicted 1008
13 SASI_Hs01_00193018 predicted 317
14 SASI_Hs01_00193019 predicted 526
15 SASI_Hs01_00193020 predicted 302
16 SASI_Hs01_00193021 predicted 433
17 SASI_Hs01_00193022 predicted 1130
18 SASI_Hs01_00193024 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057440 predicted 708
2 SASI_Rn01_00057441 predicted 295
3 SASI_Rn01_00057442 predicted 967
4 SASI_Rn01_00057443 predicted 1136
5 SASI_Rn01_00057444 predicted 225
6 SASI_Rn01_00057445 predicted 433
7 SASI_Rn01_00057446 predicted 807
8 SASI_Rn01_00057447 predicted 377
9 SASI_Rn01_00057448 predicted 934
10 SASI_Rn01_00057449 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056715 predicted 970
2 SASI_Mm01_00056716 predicted 1006
3 SASI_Mm01_00056717 predicted 269
4 SASI_Mm01_00056718 predicted 474
5 SASI_Mm01_00056719 predicted 417
6 SASI_Mm01_00056720 predicted 1301
7 SASI_Mm01_00056721 predicted 1111
8 SASI_Mm01_00056722 predicted 334
9 SASI_Mm01_00056724 predicted 201
10 SASI_Mm02_00324991 predicted 258
11 SASI_Mm01_00056723 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019785
VALIDATED
ACTR10 MISSION shRNA Bacterial Glycerol Stock
actin-related protein 10 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1334s1c1
Sequence:CCGGCCAGCCTTGCTTATTTCAAATCTCGAGATTTGAAATAAGCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1022s1c1
Sequence:CCGGGCTTGCAGAAATACGGTATTTCTCGAGAAATACCGTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019785.1-789s1c1
Sequence:CCGGCCACCTCCAAATGTTGACTATCTCGAGATAGTCAACATTTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-215s1c1
Sequence:CCGGGCCAATCAAAGTTGTTCAGTACTCGAGTACTGAACAACTTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1174s1c1
Sequence:CCGGGCCGCTCCATTTCAAAGGAATCTCGAGATTCCTTTGAAATGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-1055s21c1
Sequence:CCGGGCTTGCAGAAATACGGTATTTCTCGAGAAATACCGTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-248s21c1
Sequence:CCGGGCCAATCAAAGTTGTTCAGTACTCGAGTACTGAACAACTTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-822s21c1
Sequence:CCGGCCACCTCCAAATGTTGACTATCTCGAGATAGTCAACATTTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-1207s21c1
Sequence:CCGGGCCGCTCCATTTCAAAGGAATCTCGAGATTCCTTTGAAATGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019785.2-1367s21c1
Sequence:CCGGCCAGCCTTGCTTATTTCAAATCTCGAGATTTGAAATAAGCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019785
VALIDATED
ACTR10 MISSION shRNA shRNA Plasmid DNA
actin-related protein 10 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1334s1c1
Sequence:CCGGCCAGCCTTGCTTATTTCAAATCTCGAGATTTGAAATAAGCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1022s1c1
Sequence:CCGGGCTTGCAGAAATACGGTATTTCTCGAGAAATACCGTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019785.1-789s1c1
Sequence:CCGGCCACCTCCAAATGTTGACTATCTCGAGATAGTCAACATTTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-215s1c1
Sequence:CCGGGCCAATCAAAGTTGTTCAGTACTCGAGTACTGAACAACTTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1174s1c1
Sequence:CCGGGCCGCTCCATTTCAAAGGAATCTCGAGATTCCTTTGAAATGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-1055s21c1
Sequence:CCGGGCTTGCAGAAATACGGTATTTCTCGAGAAATACCGTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-248s21c1
Sequence:CCGGGCCAATCAAAGTTGTTCAGTACTCGAGTACTGAACAACTTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-822s21c1
Sequence:CCGGCCACCTCCAAATGTTGACTATCTCGAGATAGTCAACATTTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-1207s21c1
Sequence:CCGGGCCGCTCCATTTCAAAGGAATCTCGAGATTCCTTTGAAATGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019785.2-1367s21c1
Sequence:CCGGCCAGCCTTGCTTATTTCAAATCTCGAGATTTGAAATAAGCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019785
VALIDATED
ACTR10 MISSION shRNA Lentiviral Transduction Particles
actin-related protein 10 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1334s1c1
Sequence:CCGGCCAGCCTTGCTTATTTCAAATCTCGAGATTTGAAATAAGCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1022s1c1
Sequence:CCGGGCTTGCAGAAATACGGTATTTCTCGAGAAATACCGTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019785.1-789s1c1
Sequence:CCGGCCACCTCCAAATGTTGACTATCTCGAGATAGTCAACATTTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-215s1c1
Sequence:CCGGGCCAATCAAAGTTGTTCAGTACTCGAGTACTGAACAACTTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019785.1-1174s1c1
Sequence:CCGGGCCGCTCCATTTCAAAGGAATCTCGAGATTCCTTTGAAATGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-1055s21c1
Sequence:CCGGGCTTGCAGAAATACGGTATTTCTCGAGAAATACCGTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-248s21c1
Sequence:CCGGGCCAATCAAAGTTGTTCAGTACTCGAGTACTGAACAACTTTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-822s21c1
Sequence:CCGGCCACCTCCAAATGTTGACTATCTCGAGATAGTCAACATTTGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019785.2-1207s21c1
Sequence:CCGGGCCGCTCCATTTCAAAGGAATCTCGAGATTCCTTTGAAATGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019785.2-1367s21c1
Sequence:CCGGCCAGCCTTGCTTATTTCAAATCTCGAGATTTGAAATAAGCAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018477
VALIDATED
ACTR10 MISSION shRNA Bacterial Glycerol Stock
actin-related protein 10 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-1451s1c1
Sequence:CCGGCTGTGTTTACTCTTTGCATTACTCGAGTAATGCAAAGAGTAAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-978s1c1
Sequence:CCGGGCAGAGAATTTGGTAGTCATACTCGAGTATGACTACCAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018477.1-1260s1c1
Sequence:CCGGCCTTTGGAAATGATGTTTGATCTCGAGATCAAACATCATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-1037s1c1
Sequence:CCGGGCTTGCAGAAATAAGGTATTTCTCGAGAAATACCTTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-460s21c1
Sequence:CCGGGCTTGCTCCAAGTCATCTAATCTCGAGATTAGATGACTTGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-539s21c1
Sequence:CCGGAGCCTGGTGTTACCCATATATCTCGAGATATATGGGTAACACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-372s21c1
Sequence:CCGGTGATTATCGAATCGGTATTATCTCGAGATAATACCGATTCGATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-1374s21c1
Sequence:CCGGCAACCTTGCTTCATATCAAATCTCGAGATTTGATATGAAGCAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-1001s21c1
Sequence:CCGGGCAGAGAATTTGGTAGTCATACTCGAGTATGACTACCAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018477
VALIDATED
ACTR10 MISSION shRNA shRNA Plasmid DNA
actin-related protein 10 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-1451s1c1
Sequence:CCGGCTGTGTTTACTCTTTGCATTACTCGAGTAATGCAAAGAGTAAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-978s1c1
Sequence:CCGGGCAGAGAATTTGGTAGTCATACTCGAGTATGACTACCAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018477.1-1260s1c1
Sequence:CCGGCCTTTGGAAATGATGTTTGATCTCGAGATCAAACATCATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-1037s1c1
Sequence:CCGGGCTTGCAGAAATAAGGTATTTCTCGAGAAATACCTTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-460s21c1
Sequence:CCGGGCTTGCTCCAAGTCATCTAATCTCGAGATTAGATGACTTGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-539s21c1
Sequence:CCGGAGCCTGGTGTTACCCATATATCTCGAGATATATGGGTAACACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-372s21c1
Sequence:CCGGTGATTATCGAATCGGTATTATCTCGAGATAATACCGATTCGATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-1374s21c1
Sequence:CCGGCAACCTTGCTTCATATCAAATCTCGAGATTTGATATGAAGCAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-1001s21c1
Sequence:CCGGGCAGAGAATTTGGTAGTCATACTCGAGTATGACTACCAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018477
VALIDATED
ACTR10 MISSION shRNA Lentiviral Transduction Particles
actin-related protein 10 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-1451s1c1
Sequence:CCGGCTGTGTTTACTCTTTGCATTACTCGAGTAATGCAAAGAGTAAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-978s1c1
Sequence:CCGGGCAGAGAATTTGGTAGTCATACTCGAGTATGACTACCAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018477.1-1260s1c1
Sequence:CCGGCCTTTGGAAATGATGTTTGATCTCGAGATCAAACATCATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018477.1-1037s1c1
Sequence:CCGGGCTTGCAGAAATAAGGTATTTCTCGAGAAATACCTTATTTCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-460s21c1
Sequence:CCGGGCTTGCTCCAAGTCATCTAATCTCGAGATTAGATGACTTGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-539s21c1
Sequence:CCGGAGCCTGGTGTTACCCATATATCTCGAGATATATGGGTAACACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-372s21c1
Sequence:CCGGTGATTATCGAATCGGTATTATCTCGAGATAATACCGATTCGATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-1374s21c1
Sequence:CCGGCAACCTTGCTTCATATCAAATCTCGAGATTTGATATGAAGCAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018477.2-1001s21c1
Sequence:CCGGGCAGAGAATTTGGTAGTCATACTCGAGTATGACTACCAAATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks