EMAIL THIS PAGE TO A FRIEND

ACTR1A

ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)

206 Gene Product Result for
Synonyms: ARP1 CTRN1
UniProtKB ID: P61163, B2R6B0, P42024
Gene ID:
Human(10121) Summary: This gene encodes a 42.6 kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 8-13 copies per dynactin molecule, and is the most abundant molecule in the dynactin complex. It is an actin-related protein, and is approximately 60% identical at the amino acid level to conventional actin. [provided by RefSeq, Jul 2008]
Mouse(54130) ARP1 actin-related protein 1A, centractin alpha
Rat(294010) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Goat(100860926) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Domestic Rabbit(100341458) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
sheep(101108440) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
domestic guinea pig(100733812) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
naked mole-rat(101723337) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
chicken(423862) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
cow(514371) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Horse(100069908) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
dog(403791) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
domestic cat(101081833) ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005736 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005736 Rosetta Predictions human pricing
NM_001106364 Rosetta Predictions rat pricing
NM_016860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015229 predicted 442
2 SASI_Hs01_00015230 predicted 1211
3 SASI_Hs01_00015231 predicted 716
4 SASI_Hs02_00340174 predicted 836
5 SASI_Hs01_00015232 predicted 322
6 SASI_Hs01_00015233 predicted 708
7 SASI_Hs01_00015234 predicted 758
8 SASI_Hs01_00015236 predicted 1352
9 SASI_Hs02_00340175 predicted 1180
10 SASI_Hs01_00015237 predicted 687
11 SASI_Hs01_00015235 predicted 688
12 SASI_Hs01_00015238 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218238 predicted 1213
2 SASI_Rn02_00218239 predicted 325
3 SASI_Rn02_00218240 predicted 447
4 SASI_Rn02_00218241 predicted 398
5 SASI_Rn02_00218242 predicted 716
6 SASI_Rn02_00218243 predicted 840
7 SASI_Rn02_00218244 predicted 920
8 SASI_Rn02_00218245 predicted 1070
9 SASI_Rn02_00218246 predicted 488
10 SASI_Rn02_00218247 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021162 predicted 582
2 SASI_Mm01_00021163 predicted 916
3 SASI_Mm01_00021164 predicted 908
4 SASI_Mm01_00021165 predicted 421
5 SASI_Mm01_00021166 predicted 552
6 SASI_Mm01_00021167 predicted 713
7 SASI_Mm01_00021168 predicted 680
8 SASI_Mm01_00021169 predicted 709
9 SASI_Mm01_00021170 predicted 833
10 SASI_Mm01_00021171 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016860
VALIDATED
ACTR1A MISSION shRNA Bacterial Glycerol Stock
ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-692s21c1
Sequence:CCGGGAGATTGTCAAGGCCATAAAGCTCGAGCTTTATGGCCTTGACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-908s21c1
Sequence:CCGGCAGAAGTCAGACATGGATTTACTCGAGTAAATCCATGTCTGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-1160s21c1
Sequence:CCGGGCCCGATCCATCCACAGGAAACTCGAGTTTCCTGTGGATGGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-551s21c1
Sequence:CCGGACCCATGCAGTCCCGATTTATCTCGAGATAAATCGGGACTGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016860.1-1993s1c1
Sequence:CCGGCCTTGCTTACACTAATGTTTACTCGAGTAAACATTAGTGTAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016860.1-551s1c1
Sequence:CCGGACCCATGCAGTCCCGATTTATCTCGAGATAAATCGGGACTGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-564s1c1
Sequence:CCGGCGATTTATGAAGGCTTCGCCACTCGAGTGGCGAAGCCTTCATAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-908s1c1
Sequence:CCGGCAGAAGTCAGACATGGATTTACTCGAGTAAATCCATGTCTGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-1160s1c1
Sequence:CCGGGCCCGATCCATCCACAGGAAACTCGAGTTTCCTGTGGATGGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016860
VALIDATED
ACTR1A MISSION shRNA shRNA Plasmid DNA
ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-692s21c1
Sequence:CCGGGAGATTGTCAAGGCCATAAAGCTCGAGCTTTATGGCCTTGACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-908s21c1
Sequence:CCGGCAGAAGTCAGACATGGATTTACTCGAGTAAATCCATGTCTGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-1160s21c1
Sequence:CCGGGCCCGATCCATCCACAGGAAACTCGAGTTTCCTGTGGATGGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-551s21c1
Sequence:CCGGACCCATGCAGTCCCGATTTATCTCGAGATAAATCGGGACTGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016860.1-1993s1c1
Sequence:CCGGCCTTGCTTACACTAATGTTTACTCGAGTAAACATTAGTGTAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016860.1-551s1c1
Sequence:CCGGACCCATGCAGTCCCGATTTATCTCGAGATAAATCGGGACTGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-564s1c1
Sequence:CCGGCGATTTATGAAGGCTTCGCCACTCGAGTGGCGAAGCCTTCATAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-908s1c1
Sequence:CCGGCAGAAGTCAGACATGGATTTACTCGAGTAAATCCATGTCTGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-1160s1c1
Sequence:CCGGGCCCGATCCATCCACAGGAAACTCGAGTTTCCTGTGGATGGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016860
VALIDATED
ACTR1A MISSION shRNA Lentiviral Transduction Particles
ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-692s21c1
Sequence:CCGGGAGATTGTCAAGGCCATAAAGCTCGAGCTTTATGGCCTTGACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-908s21c1
Sequence:CCGGCAGAAGTCAGACATGGATTTACTCGAGTAAATCCATGTCTGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-1160s21c1
Sequence:CCGGGCCCGATCCATCCACAGGAAACTCGAGTTTCCTGTGGATGGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016860.1-551s21c1
Sequence:CCGGACCCATGCAGTCCCGATTTATCTCGAGATAAATCGGGACTGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016860.1-1993s1c1
Sequence:CCGGCCTTGCTTACACTAATGTTTACTCGAGTAAACATTAGTGTAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016860.1-551s1c1
Sequence:CCGGACCCATGCAGTCCCGATTTATCTCGAGATAAATCGGGACTGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-564s1c1
Sequence:CCGGCGATTTATGAAGGCTTCGCCACTCGAGTGGCGAAGCCTTCATAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-908s1c1
Sequence:CCGGCAGAAGTCAGACATGGATTTACTCGAGTAAATCCATGTCTGACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016860.1-1160s1c1
Sequence:CCGGGCCCGATCCATCCACAGGAAACTCGAGTTTCCTGTGGATGGATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005736
ACTR1A MISSION shRNA Bacterial Glycerol Stock
ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-434s21c1
Sequence:CCGGTCCTGACTGAGGCGCCTTTAACTCGAGTTAAAGGCGCCTCAGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005736.3-1267s21c1
Sequence:CCGGTGAAGTTAACTCCACTTTAAACTCGAGTTTAAAGTGGAGTTAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-153s21c1
Sequence:CCGGCAACGGATCCGGTGTGATTAACTCGAGTTAATCACACCGGATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-767s21c1
Sequence:CCGGGAGCCTGTTACCTATCCATAACTCGAGTTATGGATAGGTAACAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-741s21c1
Sequence:CCGGTGAGATTGTCAAGGCCATAAACTCGAGTTTATGGCCTTGACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005736.2-2017s1c1
Sequence:CCGGGCCTTGCTACACTAATGTTTACTCGAGTAAACATTAGTGTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-717s1c1
Sequence:CCGGAGCCTGTTACCTATCCATAAACTCGAGTTTATGGATAGGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-715s1c1
Sequence:CCGGAGAGCCTGTTACCTATCCATACTCGAGTATGGATAGGTAACAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-111s1c1
Sequence:CCGGCGGTGTGATTAAAGCTGGTTTCTCGAGAAACCAGCTTTAATCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-294s1c1
Sequence:CCGGCGTCAAGGATTGGAACGACATCTCGAGATGTCGTTCCAATCCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005736
ACTR1A MISSION shRNA shRNA Plasmid DNA
ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-434s21c1
Sequence:CCGGTCCTGACTGAGGCGCCTTTAACTCGAGTTAAAGGCGCCTCAGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005736.3-1267s21c1
Sequence:CCGGTGAAGTTAACTCCACTTTAAACTCGAGTTTAAAGTGGAGTTAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-153s21c1
Sequence:CCGGCAACGGATCCGGTGTGATTAACTCGAGTTAATCACACCGGATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-767s21c1
Sequence:CCGGGAGCCTGTTACCTATCCATAACTCGAGTTATGGATAGGTAACAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-741s21c1
Sequence:CCGGTGAGATTGTCAAGGCCATAAACTCGAGTTTATGGCCTTGACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005736.2-2017s1c1
Sequence:CCGGGCCTTGCTACACTAATGTTTACTCGAGTAAACATTAGTGTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-717s1c1
Sequence:CCGGAGCCTGTTACCTATCCATAAACTCGAGTTTATGGATAGGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-715s1c1
Sequence:CCGGAGAGCCTGTTACCTATCCATACTCGAGTATGGATAGGTAACAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-111s1c1
Sequence:CCGGCGGTGTGATTAAAGCTGGTTTCTCGAGAAACCAGCTTTAATCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-294s1c1
Sequence:CCGGCGTCAAGGATTGGAACGACATCTCGAGATGTCGTTCCAATCCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005736
ACTR1A MISSION shRNA Lentiviral Transduction Particles
ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-434s21c1
Sequence:CCGGTCCTGACTGAGGCGCCTTTAACTCGAGTTAAAGGCGCCTCAGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005736.3-1267s21c1
Sequence:CCGGTGAAGTTAACTCCACTTTAAACTCGAGTTTAAAGTGGAGTTAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-153s21c1
Sequence:CCGGCAACGGATCCGGTGTGATTAACTCGAGTTAATCACACCGGATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-767s21c1
Sequence:CCGGGAGCCTGTTACCTATCCATAACTCGAGTTATGGATAGGTAACAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005736.3-741s21c1
Sequence:CCGGTGAGATTGTCAAGGCCATAAACTCGAGTTTATGGCCTTGACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005736.2-2017s1c1
Sequence:CCGGGCCTTGCTACACTAATGTTTACTCGAGTAAACATTAGTGTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-717s1c1
Sequence:CCGGAGCCTGTTACCTATCCATAAACTCGAGTTTATGGATAGGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-715s1c1
Sequence:CCGGAGAGCCTGTTACCTATCCATACTCGAGTATGGATAGGTAACAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-111s1c1
Sequence:CCGGCGGTGTGATTAAAGCTGGTTTCTCGAGAAACCAGCTTTAATCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005736.2-294s1c1
Sequence:CCGGCGTCAAGGATTGGAACGACATCTCGAGATGTCGTTCCAATCCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks