EMAIL THIS PAGE TO A FRIEND

ACTR1B

ARP1 actin-related protein 1 homolog B, centractin beta (yeast)

54 Gene Product Result for
Synonyms: ARP1B CTRN2 PC3
UniProtKB ID: P42025, D3DVH2, Q53SK5, Q9BRB7
Gene ID:
Human(10120) Summary: This gene encodes a 42.3 kD subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein and is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like ACTR1A, is an actin-related protein. These two proteins, which are of equal length and share 90% amino acid identity, are present in a constant ratio of approximately 1:15 in the dynactin complex. [provided by RefSeq, Aug 2008]
Mouse(226977) ARP1 actin-related protein 1B, centractin beta
Rat(316333) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
cow(100125305) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Horse(100051108) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
dog(611680) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
domestic cat(101090508) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
naked mole-rat(101715545) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
domestic guinea pig(100734911) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
sheep(101112894) ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005735 Rosetta Predictions human pricing
NM_001039028 Rosetta Predictions rat pricing
NM_146107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340173 predicted 657
2 SASI_Hs01_00240072 predicted 687
3 SASI_Hs01_00240073 predicted 1627
4 SASI_Hs01_00240074 predicted 363
5 SASI_Hs01_00240075 predicted 286
6 SASI_Hs01_00240076 predicted 924
7 SASI_Hs01_00240077 predicted 479
8 SASI_Hs01_00240078 predicted 898
9 SASI_Hs01_00240079 predicted 962
10 SASI_Hs01_00240080 predicted 659
11 SASI_Hs01_00240081 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204776 predicted 414
2 SASI_Rn02_00204777 predicted 492
3 SASI_Rn01_00080310 predicted 1033
4 SASI_Rn01_00080311 predicted 913
5 SASI_Rn02_00204778 predicted 1717
6 SASI_Rn02_00204779 predicted 197
7 SASI_Rn02_00204780 predicted 364
8 SASI_Rn01_00080313 predicted 669
9 SASI_Rn02_00204781 predicted 364
10 SASI_Rn02_00204782 predicted 1462
11 SASI_Rn01_00080309 predicted 720
12 SASI_Rn01_00080312 predicted 1099
13 SASI_Rn01_00080314 predicted 661
14 SASI_Rn01_00080315 predicted 773
15 SASI_Rn01_00080316 predicted 336
16 SASI_Rn01_00080317 predicted 338
17 SASI_Rn01_00080318 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116811 predicted 375
2 SASI_Mm01_00116812 predicted 458
3 SASI_Mm01_00116813 predicted 1000
4 SASI_Mm01_00116814 predicted 880
5 SASI_Mm01_00116815 predicted 310
6 SASI_Mm01_00116816 predicted 1004
7 SASI_Mm02_00341754 predicted 1109
8 SASI_Mm01_00116817 predicted 628
9 SASI_Mm01_00116818 predicted 369
10 SASI_Mm01_00116819 predicted 427
11 SASI_Mm01_00116810 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146107
VALIDATED
ACTR1B MISSION shRNA Bacterial Glycerol Stock
ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-1806s1c1
Sequence:CCGGCCACTCTCTTTCAAAGCACTACTCGAGTAGTGCTTTGAAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146107.1-945s1c1
Sequence:CCGGCCGGACACTCTTCTCCAATATCTCGAGATATTGGAGAAGAGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-1007s1c1
Sequence:CCGGACAGGTTACTAAGTGAAGTAACTCGAGTTACTTCACTTAGTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-156s1c1
Sequence:CCGGCCAGATTCCTAAGTACTGTTTCTCGAGAAACAGTACTTAGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-313s1c1
Sequence:CCGGCGGGATTGGAATGACATGGAACTCGAGTTCCATGTCATTCCAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-1007s21c1
Sequence:CCGGACAGGTTACTAAGTGAAGTAACTCGAGTTACTTCACTTAGTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-313s21c1
Sequence:CCGGCGGGATTGGAATGACATGGAACTCGAGTTCCATGTCATTCCAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-156s21c1
Sequence:CCGGCCAGATTCCTAAGTACTGTTTCTCGAGAAACAGTACTTAGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146107.2-1806s21c1
Sequence:CCGGCCACTCTCTTTCAAAGCACTACTCGAGTAGTGCTTTGAAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-945s21c1
Sequence:CCGGCCGGACACTCTTCTCCAATATCTCGAGATATTGGAGAAGAGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146107
VALIDATED
ACTR1B MISSION shRNA shRNA Plasmid DNA
ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-1806s1c1
Sequence:CCGGCCACTCTCTTTCAAAGCACTACTCGAGTAGTGCTTTGAAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146107.1-945s1c1
Sequence:CCGGCCGGACACTCTTCTCCAATATCTCGAGATATTGGAGAAGAGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-1007s1c1
Sequence:CCGGACAGGTTACTAAGTGAAGTAACTCGAGTTACTTCACTTAGTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-156s1c1
Sequence:CCGGCCAGATTCCTAAGTACTGTTTCTCGAGAAACAGTACTTAGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-313s1c1
Sequence:CCGGCGGGATTGGAATGACATGGAACTCGAGTTCCATGTCATTCCAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-1007s21c1
Sequence:CCGGACAGGTTACTAAGTGAAGTAACTCGAGTTACTTCACTTAGTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-313s21c1
Sequence:CCGGCGGGATTGGAATGACATGGAACTCGAGTTCCATGTCATTCCAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-156s21c1
Sequence:CCGGCCAGATTCCTAAGTACTGTTTCTCGAGAAACAGTACTTAGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146107.2-1806s21c1
Sequence:CCGGCCACTCTCTTTCAAAGCACTACTCGAGTAGTGCTTTGAAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-945s21c1
Sequence:CCGGCCGGACACTCTTCTCCAATATCTCGAGATATTGGAGAAGAGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146107
VALIDATED
ACTR1B MISSION shRNA Lentiviral Transduction Particles
ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-1806s1c1
Sequence:CCGGCCACTCTCTTTCAAAGCACTACTCGAGTAGTGCTTTGAAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146107.1-945s1c1
Sequence:CCGGCCGGACACTCTTCTCCAATATCTCGAGATATTGGAGAAGAGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-1007s1c1
Sequence:CCGGACAGGTTACTAAGTGAAGTAACTCGAGTTACTTCACTTAGTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-156s1c1
Sequence:CCGGCCAGATTCCTAAGTACTGTTTCTCGAGAAACAGTACTTAGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146107.1-313s1c1
Sequence:CCGGCGGGATTGGAATGACATGGAACTCGAGTTCCATGTCATTCCAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-1007s21c1
Sequence:CCGGACAGGTTACTAAGTGAAGTAACTCGAGTTACTTCACTTAGTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-313s21c1
Sequence:CCGGCGGGATTGGAATGACATGGAACTCGAGTTCCATGTCATTCCAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-156s21c1
Sequence:CCGGCCAGATTCCTAAGTACTGTTTCTCGAGAAACAGTACTTAGGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146107.2-1806s21c1
Sequence:CCGGCCACTCTCTTTCAAAGCACTACTCGAGTAGTGCTTTGAAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146107.2-945s21c1
Sequence:CCGGCCGGACACTCTTCTCCAATATCTCGAGATATTGGAGAAGAGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005735
ACTR1B MISSION shRNA Bacterial Glycerol Stock
ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005735.2-1870s1c1
Sequence:CCGGGCCACTTAATAAGGAGTCAGACTCGAGTCTGACTCCTTATTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-108s1c1
Sequence:CCGGAGGAGACCAGATTCCCAAATACTCGAGTATTTGGGAATCTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-1132s1c1
Sequence:CCGGTCCCGTGCTATTCATCGCAAACTCGAGTTTGCGATGAATAGCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-966s1c1
Sequence:CCGGCCGATTACTCAGTGAAGTGAACTCGAGTTCACTTCACTGAGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-301s1c1
Sequence:CCGGCAGTACGTCTACTCCAAGGATCTCGAGATCCTTGGAGTAGACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-479s21c1
Sequence:CCGGCAGTACGTCTACTCCAAGGATCTCGAGATCCTTGGAGTAGACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-1310s21c1
Sequence:CCGGTCCCGTGCTATTCATCGCAAACTCGAGTTTGCGATGAATAGCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-1144s21c1
Sequence:CCGGCCGATTACTCAGTGAAGTGAACTCGAGTTCACTTCACTGAGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-286s21c1
Sequence:CCGGAGGAGACCAGATTCCCAAATACTCGAGTATTTGGGAATCTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005735.3-2045s21c1
Sequence:CCGGGCCACTTAATAAGGAGTCAGACTCGAGTCTGACTCCTTATTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005735
ACTR1B MISSION shRNA shRNA Plasmid DNA
ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005735.2-1870s1c1
Sequence:CCGGGCCACTTAATAAGGAGTCAGACTCGAGTCTGACTCCTTATTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-108s1c1
Sequence:CCGGAGGAGACCAGATTCCCAAATACTCGAGTATTTGGGAATCTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-1132s1c1
Sequence:CCGGTCCCGTGCTATTCATCGCAAACTCGAGTTTGCGATGAATAGCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-966s1c1
Sequence:CCGGCCGATTACTCAGTGAAGTGAACTCGAGTTCACTTCACTGAGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-301s1c1
Sequence:CCGGCAGTACGTCTACTCCAAGGATCTCGAGATCCTTGGAGTAGACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-479s21c1
Sequence:CCGGCAGTACGTCTACTCCAAGGATCTCGAGATCCTTGGAGTAGACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-1310s21c1
Sequence:CCGGTCCCGTGCTATTCATCGCAAACTCGAGTTTGCGATGAATAGCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-1144s21c1
Sequence:CCGGCCGATTACTCAGTGAAGTGAACTCGAGTTCACTTCACTGAGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-286s21c1
Sequence:CCGGAGGAGACCAGATTCCCAAATACTCGAGTATTTGGGAATCTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005735.3-2045s21c1
Sequence:CCGGGCCACTTAATAAGGAGTCAGACTCGAGTCTGACTCCTTATTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005735
ACTR1B MISSION shRNA Lentiviral Transduction Particles
ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005735.2-1870s1c1
Sequence:CCGGGCCACTTAATAAGGAGTCAGACTCGAGTCTGACTCCTTATTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-108s1c1
Sequence:CCGGAGGAGACCAGATTCCCAAATACTCGAGTATTTGGGAATCTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-1132s1c1
Sequence:CCGGTCCCGTGCTATTCATCGCAAACTCGAGTTTGCGATGAATAGCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-966s1c1
Sequence:CCGGCCGATTACTCAGTGAAGTGAACTCGAGTTCACTTCACTGAGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005735.2-301s1c1
Sequence:CCGGCAGTACGTCTACTCCAAGGATCTCGAGATCCTTGGAGTAGACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-479s21c1
Sequence:CCGGCAGTACGTCTACTCCAAGGATCTCGAGATCCTTGGAGTAGACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-1310s21c1
Sequence:CCGGTCCCGTGCTATTCATCGCAAACTCGAGTTTGCGATGAATAGCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-1144s21c1
Sequence:CCGGCCGATTACTCAGTGAAGTGAACTCGAGTTCACTTCACTGAGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005735.3-286s21c1
Sequence:CCGGAGGAGACCAGATTCCCAAATACTCGAGTATTTGGGAATCTGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005735.3-2045s21c1
Sequence:CCGGGCCACTTAATAAGGAGTCAGACTCGAGTCTGACTCCTTATTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks