EMAIL THIS PAGE TO A FRIEND

ACTR2

ARP2 actin-related protein 2 homolog (yeast)

123 Gene Product Result for
Synonyms: ARP2
UniProtKB ID: P61160, B2RCP5, D6W5F4, E9PF41, O15142, Q96C82
Gene ID:
Human(10097) Summary: The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(66713) ARP2 actin-related protein 2
Rat(289820) ARP2 actin-related protein 2 homolog (yeast)
Goat(100860918) ARP2 actin-related protein 2 homolog (yeast)
Domestic Rabbit(100339213) ARP2 actin-related protein 2 homolog (yeast)
sheep(101112965) ARP2 actin-related protein 2 homolog (yeast)
domestic guinea pig(100726741) ARP2 actin-related protein 2 homolog (yeast)
naked mole-rat(101711414) ARP2 actin-related protein 2 homolog (yeast)
chicken(396147) ARP2 actin-related protein 2 homolog (yeast)
cow(538486) ARP2 actin-related protein 2 homolog (yeast)
Horse(100063005) ARP2 actin-related protein 2 homolog (yeast)
domestic cat(101087729) ARP2 actin-related protein 2 homolog (yeast)
dog(481396) ARP2 actin-related protein 2 homolog (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A1232 Anti-ACTR2 (331-345) antibody produced in rabbit IgG fraction of antiserum, PBS solution human
immunofluorescence, western blot pricing
A1107 Anti-ACTR2 (52-65) antibody produced in rabbit IgG fraction of antiserum, PBS solution human
immunofluorescence, western blot pricing
HPA015050 Anti-ACTR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
AV46022 Anti-ACTR2 antibody produced in rabbit IgG fraction of antiserum mouse, rat, guinea pig, canine, pig, horse, rabbit, bovine, human, zebrafish
immunohistochemistry, western blot pricing
SAB2100042 Anti-ACTR2 antibody produced in rabbit affinity isolated antibody zebrafish, guinea pig, rabbit, rat, canine, mouse, human, bovine, horse
western blot pricing
A6104 Anti-ARP2 antibody, Mouse monoclonal clone FMS96, purified from hybridoma cell culture rat, mouse, human, canine
ELISA, immunocytochemistry, microarray, western blot pricing
WH0010097M1 Monoclonal Anti-ACTR2 antibody produced in mouse clone 1B10-C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005386 Rosetta Predictions human pricing
NM_005722 Rosetta Predictions human pricing
NM_001009268 Rosetta Predictions rat pricing
NM_146243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073833 predicted 587
2 SASI_Hs01_00073834 predicted 1207
3 SASI_Hs01_00073835 predicted 864
4 SASI_Hs01_00073836 predicted 821
5 SASI_Hs01_00073837 predicted 1057
6 SASI_Hs01_00073838 predicted 641
7 SASI_Hs01_00073840 predicted 709
8 SASI_Hs01_00073841 predicted 749
9 SASI_Hs02_00304889 predicted 680
10 SASI_Hs02_00304890 predicted 534
11 SASI_Hs01_00073839 predicted 1042
12 SASI_Hs01_00073842 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155890 predicted 569
2 SASI_Hs01_00155891 predicted 1199
3 SASI_Hs01_00155892 predicted 844
4 SASI_Hs01_00155893 predicted 802
5 SASI_Hs01_00155894 predicted 1048
6 SASI_Hs01_00155895 predicted 630
7 SASI_Hs01_00155897 predicted 699
8 SASI_Hs01_00155898 predicted 738
9 SASI_Hs02_00340144 predicted 664
10 SASI_Hs02_00340145 predicted 519
11 SASI_Hs01_00155896 predicted 1025
12 SASI_Hs01_00155899 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034744 predicted 1018
2 SASI_Rn01_00034745 predicted 1004
3 SASI_Rn01_00034746 predicted 661
4 SASI_Rn01_00034747 predicted 593
5 SASI_Rn01_00034748 predicted 758
6 SASI_Rn02_00199504 predicted 930
7 SASI_Rn01_00034749 predicted 618
8 SASI_Rn01_00034750 predicted 546
9 SASI_Rn02_00199505 predicted 666
10 SASI_Rn01_00034752 predicted 413
11 SASI_Rn01_00034751 predicted 695
12 SASI_Rn01_00034753 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341966 predicted 439
2 SASI_Mm01_00171837 predicted 612
3 SASI_Mm01_00171838 predicted 737
4 SASI_Mm01_00171840 predicted 950
5 SASI_Mm01_00171841 predicted 683
6 SASI_Mm01_00171834 predicted 263
7 SASI_Mm01_00171842 predicted 569
8 SASI_Mm01_00171843 predicted 638
9 SASI_Mm02_00341967 predicted 799
10 SASI_Mm02_00341968 predicted 977
11 SASI_Mm01_00171835 predicted 627
12 SASI_Mm01_00171836 predicted 878
13 SASI_Mm01_00171839 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005386
VALIDATED
ACTR2 MISSION shRNA Bacterial Glycerol Stock
ARP2 actin-related protein 2 homolog (yeast)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-720s21c1
Sequence:GTACCGGACTCACATTTGCCCAGTATATCTCGAGATATACTGGGCAAATGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-1175s21c1
Sequence:GTACCGGACGGTTGGAACGAGAACTTAACTCGAGTTAAGTTCTCGTTCCAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-282s21c1
Sequence:CCGGGCAGGCTCTAACTTTCCAGAACTCGAGTTCTGGAAAGTTAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-940s21c1
Sequence:CCGGCCACAGTATTAGTTGAATCTTCTCGAGAAGATTCAACTAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1928s21c1
Sequence:CCGGCCTGTGAACTTCTTAGGGAAACTCGAGTTTCCCTAAGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1723s21c1
Sequence:CCGGTGCTGCTAGTCGTAGTCTTTACTCGAGTAAAGACTACGACTAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1848s21c1
Sequence:CCGGGCTGAACCCTTTAGGGCATTTCTCGAGAAATGCCCTAAAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-489s21c1
Sequence:GTACCGGCACCTGTGGGACTACACATTTCTCGAGAAATGTGTAGTCCCACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-1396s21c1
Sequence:GTACCGGTTGGTGTGACTGTTCGATAAACTCGAGTTTATCGAACAGTCACACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-1855s1c1
Sequence:CCGGCCTGTGAACTTCTTAGGGAAACTCGAGTTTCCCTAAGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005386.1-656s1c1
Sequence:CCGGTGCCCAGTATATGAAGGCTTTCTCGAGAAAGCCTTCATATACTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001005386.1-867s1c1
Sequence:CCGGCCACAGTATTAGTTGAATCTTCTCGAGAAGATTCAACTAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-209s1c1
Sequence:CCGGGCAGGCTCTAACTTTCCAGAACTCGAGTTCTGGAAAGTTAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-491s1c1
Sequence:CCGGCCTCCTATGAACCCAACCAAACTCGAGTTTGGTTGGGTTCATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005386
VALIDATED
ACTR2 MISSION shRNA shRNA Plasmid DNA
ARP2 actin-related protein 2 homolog (yeast)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-720s21c1
Sequence:GTACCGGACTCACATTTGCCCAGTATATCTCGAGATATACTGGGCAAATGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-1175s21c1
Sequence:GTACCGGACGGTTGGAACGAGAACTTAACTCGAGTTAAGTTCTCGTTCCAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-282s21c1
Sequence:CCGGGCAGGCTCTAACTTTCCAGAACTCGAGTTCTGGAAAGTTAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-940s21c1
Sequence:CCGGCCACAGTATTAGTTGAATCTTCTCGAGAAGATTCAACTAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1928s21c1
Sequence:CCGGCCTGTGAACTTCTTAGGGAAACTCGAGTTTCCCTAAGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1723s21c1
Sequence:CCGGTGCTGCTAGTCGTAGTCTTTACTCGAGTAAAGACTACGACTAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1848s21c1
Sequence:CCGGGCTGAACCCTTTAGGGCATTTCTCGAGAAATGCCCTAAAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-489s21c1
Sequence:GTACCGGCACCTGTGGGACTACACATTTCTCGAGAAATGTGTAGTCCCACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-1396s21c1
Sequence:GTACCGGTTGGTGTGACTGTTCGATAAACTCGAGTTTATCGAACAGTCACACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-1855s1c1
Sequence:CCGGCCTGTGAACTTCTTAGGGAAACTCGAGTTTCCCTAAGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005386.1-656s1c1
Sequence:CCGGTGCCCAGTATATGAAGGCTTTCTCGAGAAAGCCTTCATATACTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001005386.1-867s1c1
Sequence:CCGGCCACAGTATTAGTTGAATCTTCTCGAGAAGATTCAACTAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-209s1c1
Sequence:CCGGGCAGGCTCTAACTTTCCAGAACTCGAGTTCTGGAAAGTTAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-491s1c1
Sequence:CCGGCCTCCTATGAACCCAACCAAACTCGAGTTTGGTTGGGTTCATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005386
VALIDATED
ACTR2 MISSION shRNA Lentiviral Transduction Particles
ARP2 actin-related protein 2 homolog (yeast)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-720s21c1
Sequence:GTACCGGACTCACATTTGCCCAGTATATCTCGAGATATACTGGGCAAATGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-1175s21c1
Sequence:GTACCGGACGGTTGGAACGAGAACTTAACTCGAGTTAAGTTCTCGTTCCAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-282s21c1
Sequence:CCGGGCAGGCTCTAACTTTCCAGAACTCGAGTTCTGGAAAGTTAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-940s21c1
Sequence:CCGGCCACAGTATTAGTTGAATCTTCTCGAGAAGATTCAACTAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1928s21c1
Sequence:CCGGCCTGTGAACTTCTTAGGGAAACTCGAGTTTCCCTAAGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1723s21c1
Sequence:CCGGTGCTGCTAGTCGTAGTCTTTACTCGAGTAAAGACTACGACTAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005386.2-1848s21c1
Sequence:CCGGGCTGAACCCTTTAGGGCATTTCTCGAGAAATGCCCTAAAGGGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-489s21c1
Sequence:GTACCGGCACCTGTGGGACTACACATTTCTCGAGAAATGTGTAGTCCCACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005386.2-1396s21c1
Sequence:GTACCGGTTGGTGTGACTGTTCGATAAACTCGAGTTTATCGAACAGTCACACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-1855s1c1
Sequence:CCGGCCTGTGAACTTCTTAGGGAAACTCGAGTTTCCCTAAGAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005386.1-656s1c1
Sequence:CCGGTGCCCAGTATATGAAGGCTTTCTCGAGAAAGCCTTCATATACTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001005386.1-867s1c1
Sequence:CCGGCCACAGTATTAGTTGAATCTTCTCGAGAAGATTCAACTAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-209s1c1
Sequence:CCGGGCAGGCTCTAACTTTCCAGAACTCGAGTTCTGGAAAGTTAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005386.1-491s1c1
Sequence:CCGGCCTCCTATGAACCCAACCAAACTCGAGTTTGGTTGGGTTCATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146243
VALIDATED
ACTR2 MISSION shRNA Bacterial Glycerol Stock
ARP2 actin-related protein 2 homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-871s1c1
Sequence:CCGGAGGCTTTATTTCAGCCTCATTCTCGAGAATGAGGCTGAAATAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-691s1c1
Sequence:CCGGCCTTCAACCATTCTGCTGATTCTCGAGAATCAGCAGAATGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-690s1c1
Sequence:CCGGGCCTTCAACCATTCTGCTGATCTCGAGATCAGCAGAATGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146243.1-614s1c1
Sequence:CCGGCCTTACAAGGAGGCTGGATATCTCGAGATATCCAGCCTCCTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146243.1-3328s1c1
Sequence:CCGGGCCAGGTTTGAGTCCTTCAAACTCGAGTTTGAAGGACTCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146243
VALIDATED
ACTR2 MISSION shRNA shRNA Plasmid DNA
ARP2 actin-related protein 2 homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-871s1c1
Sequence:CCGGAGGCTTTATTTCAGCCTCATTCTCGAGAATGAGGCTGAAATAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-691s1c1
Sequence:CCGGCCTTCAACCATTCTGCTGATTCTCGAGAATCAGCAGAATGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-690s1c1
Sequence:CCGGGCCTTCAACCATTCTGCTGATCTCGAGATCAGCAGAATGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146243.1-614s1c1
Sequence:CCGGCCTTACAAGGAGGCTGGATATCTCGAGATATCCAGCCTCCTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146243.1-3328s1c1
Sequence:CCGGGCCAGGTTTGAGTCCTTCAAACTCGAGTTTGAAGGACTCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146243
VALIDATED
ACTR2 MISSION shRNA Lentiviral Transduction Particles
ARP2 actin-related protein 2 homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-871s1c1
Sequence:CCGGAGGCTTTATTTCAGCCTCATTCTCGAGAATGAGGCTGAAATAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-691s1c1
Sequence:CCGGCCTTCAACCATTCTGCTGATTCTCGAGAATCAGCAGAATGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146243.1-690s1c1
Sequence:CCGGGCCTTCAACCATTCTGCTGATCTCGAGATCAGCAGAATGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146243.1-614s1c1
Sequence:CCGGCCTTACAAGGAGGCTGGATATCTCGAGATATCCAGCCTCCTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146243.1-3328s1c1
Sequence:CCGGGCCAGGTTTGAGTCCTTCAAACTCGAGTTTGAAGGACTCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks