EMAIL THIS PAGE TO A FRIEND

ACTR3

ARP3 actin-related protein 3 homolog (yeast)

124 Gene Product Result for
Synonyms: ARP3
UniProtKB ID: P61158, P32391, Q53QM2
Gene ID:
Human(10096) Summary: The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Mouse(74117) ARP3 actin-related protein 3
Rat(81732) ARP3 actin-related protein 3 homolog (yeast)
Zebrafish(406250) ARP3 actin-related protein 3 homolog (yeast)
chicken(374197) ARP3 actin-related protein 3 homolog (yeast)
domestic cat(101087419) ARP3 actin-related protein 3 homolog (yeast)
cow(281597) ARP3 actin-related protein 3 homolog (yeast)
dog(475549) ARP3 actin-related protein 3 homolog (yeast)
domestic guinea pig(100713982) ARP3 actin-related protein 3 homolog (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005721 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005721 Rosetta Predictions human pricing
NM_031068 Rosetta Predictions rat pricing
NM_023735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209497 predicted 1370
2 SASI_Hs01_00209498 predicted 473
3 SASI_Hs01_00209501 predicted 1432
4 SASI_Hs01_00209503 predicted 1439
5 SASI_Hs01_00209504 predicted 458
6 SASI_Hs01_00209505 predicted 700
7 SASI_Hs02_00340140 predicted 1343
8 SASI_Hs02_00340141 predicted 497
9 SASI_Hs02_00340142 predicted 1357
10 SASI_Hs02_00340143 predicted 418
11 SASI_Hs01_00209496 predicted 1346
12 SASI_Hs01_00209499 predicted 1523
13 SASI_Hs01_00209500 predicted 1286
14 SASI_Hs01_00209502 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063430 predicted 357
2 SASI_Rn01_00063431 predicted 1166
3 SASI_Rn01_00063432 predicted 465
4 SASI_Rn01_00063435 predicted 1065
5 SASI_Rn01_00063436 predicted 813
6 SASI_Rn01_00063437 predicted 1144
7 SASI_Rn01_00063438 predicted 1296
8 SASI_Rn01_00063439 predicted 900
9 SASI_Rn02_00264310 predicted 1285
10 SASI_Rn02_00264311 predicted 1369
11 SASI_Rn01_00063433 predicted 874
12 SASI_Rn01_00063434 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074995 predicted 426
2 SASI_Mm01_00074996 predicted 1016
3 SASI_Mm01_00074997 predicted 1146
4 SASI_Mm01_00074998 predicted 1356
5 SASI_Mm01_00074999 predicted 1154
6 SASI_Mm01_00075000 predicted 1370
7 SASI_Mm01_00075001 predicted 263
8 SASI_Mm01_00075002 predicted 835
9 SASI_Mm01_00075003 predicted 402
10 SASI_Mm01_00075004 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023735
VALIDATED
ACTR3 MISSION shRNA Bacterial Glycerol Stock
ARP3 actin-related protein 3 homolog (yeast)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-1558s1c1
Sequence:CCGGGCAGATGTAGAAGAGAGCTAACTCGAGTTAGCTCTCTTCTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-254s1c1
Sequence:CCGGTCCCATCATGTATTGCCATTACTCGAGTAATGGCAATACATGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-943s1c1
Sequence:CCGGGCCATCTCAAAGAAAGAGTTTCTCGAGAAACTCTTTCTTTGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-472s1c1
Sequence:CCGGGAACCTGAAGATCATTACTTTCTCGAGAAAGTAATGATCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-255s1c1
Sequence:CCGGCCCATCATGTATTGCCATTAACTCGAGTTAATGGCAATACATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023735.1-645s21c1
Sequence:GTACCGGGACGCTGACGGGTACAGTAATCTCGAGATTACTGTACCCGTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-191s21c1
Sequence:CCGGTGGACTGTGGCACGGGATATACTCGAGTATATCCCGTGCCACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-743s21c1
Sequence:CCGGCAATCGCAGGAAGAGATATAACTCGAGTTATATCTCTTCCTGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-472s21c1
Sequence:CCGGGAACCTGAAGATCATTACTTTCTCGAGAAAGTAATGATCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-1558s21c1
Sequence:CCGGGCAGATGTAGAAGAGAGCTAACTCGAGTTAGCTCTCTTCTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-1245s21c1
Sequence:CCGGGCCTATTGATGTACAAGTTATCTCGAGATAACTTGTACATCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023735.1-389s21c1
Sequence:GTACCGGGGCCAATTCGCCATGGTATAGCTCGAGCTATACCATGGCGAATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023735
VALIDATED
ACTR3 MISSION shRNA shRNA Plasmid DNA
ARP3 actin-related protein 3 homolog (yeast)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-1558s1c1
Sequence:CCGGGCAGATGTAGAAGAGAGCTAACTCGAGTTAGCTCTCTTCTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-254s1c1
Sequence:CCGGTCCCATCATGTATTGCCATTACTCGAGTAATGGCAATACATGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-943s1c1
Sequence:CCGGGCCATCTCAAAGAAAGAGTTTCTCGAGAAACTCTTTCTTTGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-472s1c1
Sequence:CCGGGAACCTGAAGATCATTACTTTCTCGAGAAAGTAATGATCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-255s1c1
Sequence:CCGGCCCATCATGTATTGCCATTAACTCGAGTTAATGGCAATACATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023735.1-645s21c1
Sequence:GTACCGGGACGCTGACGGGTACAGTAATCTCGAGATTACTGTACCCGTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-191s21c1
Sequence:CCGGTGGACTGTGGCACGGGATATACTCGAGTATATCCCGTGCCACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-743s21c1
Sequence:CCGGCAATCGCAGGAAGAGATATAACTCGAGTTATATCTCTTCCTGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-472s21c1
Sequence:CCGGGAACCTGAAGATCATTACTTTCTCGAGAAAGTAATGATCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-1558s21c1
Sequence:CCGGGCAGATGTAGAAGAGAGCTAACTCGAGTTAGCTCTCTTCTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-1245s21c1
Sequence:CCGGGCCTATTGATGTACAAGTTATCTCGAGATAACTTGTACATCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023735.1-389s21c1
Sequence:GTACCGGGGCCAATTCGCCATGGTATAGCTCGAGCTATACCATGGCGAATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023735
VALIDATED
ACTR3 MISSION shRNA Lentiviral Transduction Particles
ARP3 actin-related protein 3 homolog (yeast)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-1558s1c1
Sequence:CCGGGCAGATGTAGAAGAGAGCTAACTCGAGTTAGCTCTCTTCTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-254s1c1
Sequence:CCGGTCCCATCATGTATTGCCATTACTCGAGTAATGGCAATACATGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-943s1c1
Sequence:CCGGGCCATCTCAAAGAAAGAGTTTCTCGAGAAACTCTTTCTTTGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-472s1c1
Sequence:CCGGGAACCTGAAGATCATTACTTTCTCGAGAAAGTAATGATCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023735.1-255s1c1
Sequence:CCGGCCCATCATGTATTGCCATTAACTCGAGTTAATGGCAATACATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023735.1-645s21c1
Sequence:GTACCGGGACGCTGACGGGTACAGTAATCTCGAGATTACTGTACCCGTCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-191s21c1
Sequence:CCGGTGGACTGTGGCACGGGATATACTCGAGTATATCCCGTGCCACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-743s21c1
Sequence:CCGGCAATCGCAGGAAGAGATATAACTCGAGTTATATCTCTTCCTGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-472s21c1
Sequence:CCGGGAACCTGAAGATCATTACTTTCTCGAGAAAGTAATGATCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-1558s21c1
Sequence:CCGGGCAGATGTAGAAGAGAGCTAACTCGAGTTAGCTCTCTTCTACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023735.1-1245s21c1
Sequence:CCGGGCCTATTGATGTACAAGTTATCTCGAGATAACTTGTACATCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023735.1-389s21c1
Sequence:GTACCGGGGCCAATTCGCCATGGTATAGCTCGAGCTATACCATGGCGAATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005721
VALIDATED
ACTR3 MISSION shRNA Bacterial Glycerol Stock
ARP3 actin-related protein 3 homolog (yeast)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-663s1c1
Sequence:CCGGCCTCCATTGAATACTCCAGAACTCGAGTTCTGGAGTATTCAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-1257s1c1
Sequence:CCGGCGTCCTCTCTACAAGAATATTCTCGAGAATATTCTTGTAGAGAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-413s1c1
Sequence:CCGGCCCTTCCTGTATTGCTATTAACTCGAGTTAATAGCAATACAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-1358s1c1
Sequence:CCGGGCTGAAATTAAGTGAGGAATTCTCGAGAATTCCTCACTTAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-556s1c1
Sequence:CCGGGCCATGGTATAGTTGAAGATTCTCGAGAATCTTCAACTATACCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-413s21c1
Sequence:CCGGCCCTTCCTGTATTGCTATTAACTCGAGTTAATAGCAATACAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-663s21c1
Sequence:CCGGCCTCCATTGAATACTCCAGAACTCGAGTTCTGGAGTATTCAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-1257s21c1
Sequence:CCGGCGTCCTCTCTACAAGAATATTCTCGAGAATATTCTTGTAGAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-556s21c1
Sequence:CCGGGCCATGGTATAGTTGAAGATTCTCGAGAATCTTCAACTATACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005721.3-1358s21c1
Sequence:CCGGGCTGAAATTAAGTGAGGAATTCTCGAGAATTCCTCACTTAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-1687s21c1
Sequence:GTACCGGGTAACACCAAACATGATTATACTCGAGTATAATCATGTTTGGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005721
VALIDATED
ACTR3 MISSION shRNA shRNA Plasmid DNA
ARP3 actin-related protein 3 homolog (yeast)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-663s1c1
Sequence:CCGGCCTCCATTGAATACTCCAGAACTCGAGTTCTGGAGTATTCAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-1257s1c1
Sequence:CCGGCGTCCTCTCTACAAGAATATTCTCGAGAATATTCTTGTAGAGAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-413s1c1
Sequence:CCGGCCCTTCCTGTATTGCTATTAACTCGAGTTAATAGCAATACAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-1358s1c1
Sequence:CCGGGCTGAAATTAAGTGAGGAATTCTCGAGAATTCCTCACTTAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-556s1c1
Sequence:CCGGGCCATGGTATAGTTGAAGATTCTCGAGAATCTTCAACTATACCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-413s21c1
Sequence:CCGGCCCTTCCTGTATTGCTATTAACTCGAGTTAATAGCAATACAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-663s21c1
Sequence:CCGGCCTCCATTGAATACTCCAGAACTCGAGTTCTGGAGTATTCAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-1257s21c1
Sequence:CCGGCGTCCTCTCTACAAGAATATTCTCGAGAATATTCTTGTAGAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-556s21c1
Sequence:CCGGGCCATGGTATAGTTGAAGATTCTCGAGAATCTTCAACTATACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005721.3-1358s21c1
Sequence:CCGGGCTGAAATTAAGTGAGGAATTCTCGAGAATTCCTCACTTAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-1687s21c1
Sequence:GTACCGGGTAACACCAAACATGATTATACTCGAGTATAATCATGTTTGGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005721
VALIDATED
ACTR3 MISSION shRNA Lentiviral Transduction Particles
ARP3 actin-related protein 3 homolog (yeast)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-663s1c1
Sequence:CCGGCCTCCATTGAATACTCCAGAACTCGAGTTCTGGAGTATTCAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-1257s1c1
Sequence:CCGGCGTCCTCTCTACAAGAATATTCTCGAGAATATTCTTGTAGAGAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-413s1c1
Sequence:CCGGCCCTTCCTGTATTGCTATTAACTCGAGTTAATAGCAATACAGGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-1358s1c1
Sequence:CCGGGCTGAAATTAAGTGAGGAATTCTCGAGAATTCCTCACTTAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005721.3-556s1c1
Sequence:CCGGGCCATGGTATAGTTGAAGATTCTCGAGAATCTTCAACTATACCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-413s21c1
Sequence:CCGGCCCTTCCTGTATTGCTATTAACTCGAGTTAATAGCAATACAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-663s21c1
Sequence:CCGGCCTCCATTGAATACTCCAGAACTCGAGTTCTGGAGTATTCAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-1257s21c1
Sequence:CCGGCGTCCTCTCTACAAGAATATTCTCGAGAATATTCTTGTAGAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-556s21c1
Sequence:CCGGGCCATGGTATAGTTGAAGATTCTCGAGAATCTTCAACTATACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005721.3-1358s21c1
Sequence:CCGGGCTGAAATTAAGTGAGGAATTCTCGAGAATTCCTCACTTAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005721.3-1687s21c1
Sequence:GTACCGGGTAACACCAAACATGATTATACTCGAGTATAATCATGTTTGGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks