EMAIL THIS PAGE TO A FRIEND

ACTR3B

ARP3 actin-related protein 3 homolog B (yeast)

105 Gene Product Result for
Synonyms: ARP11 ARP3BETA
UniProtKB ID: Q9P1U1, A8MTG1, B4DFW4, Q7Z526, Q96BT2
Gene ID:
Human(57180) Summary: This gene encodes a member of the actin-related proteins (ARP), which form multiprotein complexes and share 35-55% amino acid identity with conventional actin. The protein encoded by this gene may have a regulatory role in the actin cytoskeleton and induce cell-shape change and motility. Pseudogenes of this gene are located on chromosomes 2, 4, 10, 16, 22 and Y. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(242894) ARP3 actin-related protein 3B
Rat(362298) ARP3 actin-related protein 3 homolog B (yeast)
domestic guinea pig(100716996) ARP3 actin-related protein 3 homolog B (yeast)
naked mole-rat(101696570) ARP3 actin-related protein 3 homolog B (yeast)
sheep(101105653) ARP3 actin-related protein 3 homolog B (yeast)
Domestic Rabbit(100343474) ARP3 actin-related protein 3 homolog B (yeast)
Zebrafish(100038776) ARP3 actin-related protein 3 homolog B (yeast)
cow(616404) ARP3 actin-related protein 3 homolog B (yeast)
Horse(100065073) ARP3 actin-related protein 3 homolog B (yeast)
chicken(420439) ARP3 actin-related protein 3 homolog B (yeast)
domestic cat(101086891) ARP3 actin-related protein 3 homolog B (yeast)
dog(403702) ARP3 actin-related protein 3 homolog B (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040135 Rosetta Predictions human pricing
NM_020445 Rosetta Predictions human pricing
XM_001058018 Rosetta Predictions rat pricing
XM_342611 Rosetta Predictions rat pricing
NM_001004365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124746 predicted 497
2 SASI_Hs01_00124747 predicted 309
3 SASI_Hs02_00308849 predicted 660
4 SASI_Hs01_00124748 predicted 695
5 SASI_Hs01_00124749 predicted 306
6 SASI_Hs01_00124750 predicted 447
7 SASI_Hs01_00124751 predicted 702
8 SASI_Hs02_00308850 predicted 784
9 SASI_Hs01_00124753 predicted 704
10 SASI_Hs01_00124754 predicted 330
11 SASI_Hs01_00124752 predicted 624
12 SASI_Hs01_00124755 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040129 predicted 500
2 SASI_Hs01_00040130 predicted 318
3 SASI_Hs01_00040132 predicted 304
4 SASI_Hs01_00040135 predicted 626
5 SASI_Hs01_00040137 predicted 333
6 SASI_Hs01_00040138 predicted 564
7 SASI_Hs02_00353478 predicted 313
8 SASI_Hs02_00353479 predicted 515
9 SASI_Hs02_00353480 predicted 641
10 SASI_Hs02_00353481 predicted 524
11 SASI_Hs01_00040131 predicted 701
12 SASI_Hs01_00040133 predicted 452
13 SASI_Hs01_00040134 predicted 708
14 SASI_Hs01_00040136 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288286 predicted 272
2 SASI_Rn02_00288287 predicted 404
3 SASI_Rn02_00288288 predicted 516
4 SASI_Rn02_00288289 predicted 498
5 SASI_Rn02_00288290 predicted 256
6 SASI_Rn02_00288291 predicted 676
7 SASI_Rn02_00288292 predicted 359
8 SASI_Rn02_00288293 predicted 608
9 SASI_Rn02_00288294 predicted 611
10 SASI_Rn02_00288295 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394560 predicted 1819
2 SASI_Rn02_00394561 predicted 1794
3 SASI_Rn02_00394562 predicted 1201
4 SASI_Rn02_00394563 predicted 1809
5 SASI_Rn02_00394564 predicted 1221
6 SASI_Rn02_00394565 predicted 1769
7 SASI_Rn02_00394566 predicted 1141
8 SASI_Rn02_00394567 predicted 1102
9 SASI_Rn02_00394568 predicted 1151
10 SASI_Rn02_00394569 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106022 predicted 925
2 SASI_Mm01_00106023 predicted 641
3 SASI_Mm01_00106025 predicted 855
4 SASI_Mm01_00106026 predicted 604
5 SASI_Mm01_00106027 predicted 967
6 SASI_Mm01_00106028 predicted 735
7 SASI_Mm01_00106029 predicted 1085
8 SASI_Mm01_00106030 predicted 1205
9 SASI_Mm01_00106031 predicted 1239
10 SASI_Mm02_00286543 predicted 1125
11 SASI_Mm01_00106024 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020445
VALIDATED
ACTR3B MISSION shRNA Bacterial Glycerol Stock
ARP3 actin-related protein 3 homolog B (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-362s21c1
Sequence:CCGGTCATTGAAGACTGGGATCTTACTCGAGTAAGATCCCAGTCTTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-200s21c1
Sequence:CCGGAGTTCATTATTCCTTCATGTACTCGAGTACATGAAGGAATAATGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-232s21c1
Sequence:CCGGGAGTCAGCAAAGGTAGTTGACCTCGAGGTCAACTACCTTTGCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-347s21c1
Sequence:CCGGCGATACGACATGGAATCATTGCTCGAGCAATGATTCCATGTCGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-302s21c1
Sequence:CCGGTAGGAGATGAAGCCATCGATACTCGAGTATCGATGGCTTCATCTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-1605s1c1
Sequence:CCGGGCTGACAAATACAATTCTGAACTCGAGTTCAGAATTGTATTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020445.3-1029s1c1
Sequence:CCGGCCGCTGTATAAGAATGTCGTACTCGAGTACGACATTCTTATACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-498s1c1
Sequence:CCGGCCAGGACTCTACATTGCAGTTCTCGAGAACTGCAATGTAGAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-285s1c1
Sequence:CCGGGCCATCGATAAACCTACATATCTCGAGATATGTAGGTTTATCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020445.3-1184s1c1
Sequence:CCGGCCAGGTGGTCACGCATCACATCTCGAGATGTGATGCGTGACCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020445
VALIDATED
ACTR3B MISSION shRNA shRNA Plasmid DNA
ARP3 actin-related protein 3 homolog B (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-362s21c1
Sequence:CCGGTCATTGAAGACTGGGATCTTACTCGAGTAAGATCCCAGTCTTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-200s21c1
Sequence:CCGGAGTTCATTATTCCTTCATGTACTCGAGTACATGAAGGAATAATGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-232s21c1
Sequence:CCGGGAGTCAGCAAAGGTAGTTGACCTCGAGGTCAACTACCTTTGCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-347s21c1
Sequence:CCGGCGATACGACATGGAATCATTGCTCGAGCAATGATTCCATGTCGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-302s21c1
Sequence:CCGGTAGGAGATGAAGCCATCGATACTCGAGTATCGATGGCTTCATCTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-1605s1c1
Sequence:CCGGGCTGACAAATACAATTCTGAACTCGAGTTCAGAATTGTATTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020445.3-1029s1c1
Sequence:CCGGCCGCTGTATAAGAATGTCGTACTCGAGTACGACATTCTTATACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-498s1c1
Sequence:CCGGCCAGGACTCTACATTGCAGTTCTCGAGAACTGCAATGTAGAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-285s1c1
Sequence:CCGGGCCATCGATAAACCTACATATCTCGAGATATGTAGGTTTATCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020445.3-1184s1c1
Sequence:CCGGCCAGGTGGTCACGCATCACATCTCGAGATGTGATGCGTGACCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020445
VALIDATED
ACTR3B MISSION shRNA Lentiviral Transduction Particles
ARP3 actin-related protein 3 homolog B (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-362s21c1
Sequence:CCGGTCATTGAAGACTGGGATCTTACTCGAGTAAGATCCCAGTCTTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-200s21c1
Sequence:CCGGAGTTCATTATTCCTTCATGTACTCGAGTACATGAAGGAATAATGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-232s21c1
Sequence:CCGGGAGTCAGCAAAGGTAGTTGACCTCGAGGTCAACTACCTTTGCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-347s21c1
Sequence:CCGGCGATACGACATGGAATCATTGCTCGAGCAATGATTCCATGTCGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020445.4-302s21c1
Sequence:CCGGTAGGAGATGAAGCCATCGATACTCGAGTATCGATGGCTTCATCTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-1605s1c1
Sequence:CCGGGCTGACAAATACAATTCTGAACTCGAGTTCAGAATTGTATTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020445.3-1029s1c1
Sequence:CCGGCCGCTGTATAAGAATGTCGTACTCGAGTACGACATTCTTATACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-498s1c1
Sequence:CCGGCCAGGACTCTACATTGCAGTTCTCGAGAACTGCAATGTAGAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020445.3-285s1c1
Sequence:CCGGGCCATCGATAAACCTACATATCTCGAGATATGTAGGTTTATCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020445.3-1184s1c1
Sequence:CCGGCCAGGTGGTCACGCATCACATCTCGAGATGTGATGCGTGACCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004365
ACTR3B MISSION shRNA Bacterial Glycerol Stock
ARP3 actin-related protein 3 homolog B (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004365.1-1556s1c1
Sequence:CCGGCCGAGATTCTAGTCAAGTGTACTCGAGTACACTTGACTAGAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-468s1c1
Sequence:CCGGCCAGGACTCTACATTGCAGTACTCGAGTACTGCAATGTAGAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-786s1c1
Sequence:CCGGGCTAAGTATGACGTAGATCCTCTCGAGAGGATCTACGTCATACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-763s1c1
Sequence:CCGGGCCCGGATATTGTCAGAGAATCTCGAGATTCTCTGACAATATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-999s1c1
Sequence:CCGGCCGCTGTATAAGAACGTCGTTCTCGAGAACGACGTTCTTATACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004365
ACTR3B MISSION shRNA shRNA Plasmid DNA
ARP3 actin-related protein 3 homolog B (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004365.1-1556s1c1
Sequence:CCGGCCGAGATTCTAGTCAAGTGTACTCGAGTACACTTGACTAGAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-468s1c1
Sequence:CCGGCCAGGACTCTACATTGCAGTACTCGAGTACTGCAATGTAGAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-786s1c1
Sequence:CCGGGCTAAGTATGACGTAGATCCTCTCGAGAGGATCTACGTCATACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-763s1c1
Sequence:CCGGGCCCGGATATTGTCAGAGAATCTCGAGATTCTCTGACAATATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-999s1c1
Sequence:CCGGCCGCTGTATAAGAACGTCGTTCTCGAGAACGACGTTCTTATACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004365
ACTR3B MISSION shRNA Lentiviral Transduction Particles
ARP3 actin-related protein 3 homolog B (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004365.1-1556s1c1
Sequence:CCGGCCGAGATTCTAGTCAAGTGTACTCGAGTACACTTGACTAGAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-468s1c1
Sequence:CCGGCCAGGACTCTACATTGCAGTACTCGAGTACTGCAATGTAGAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-786s1c1
Sequence:CCGGGCTAAGTATGACGTAGATCCTCTCGAGAGGATCTACGTCATACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-763s1c1
Sequence:CCGGGCCCGGATATTGTCAGAGAATCTCGAGATTCTCTGACAATATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004365.1-999s1c1
Sequence:CCGGCCGCTGTATAAGAACGTCGTTCTCGAGAACGACGTTCTTATACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks