EMAIL THIS PAGE TO A FRIEND

ACTR3BP2

ACTR3B pseudogene 2

12 Gene Product Result for
Synonyms: FKSG73
Species: Human ACTR3BP2(440888)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001032412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032412 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090207 predicted 198
2 SASI_Hs01_00090208 predicted 592
3 SASI_Hs01_00090209 predicted 548
4 SASI_Hs01_00090210 predicted 529
5 SASI_Hs01_00090211 predicted 599
6 SASI_Hs01_00090212 predicted 434
7 SASI_Hs01_00090213 predicted 653
8 SASI_Hs01_00090214 predicted 639
9 SASI_Hs01_00090215 predicted 511
10 SASI_Hs01_00090216 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032412
ACTR3BP2 MISSION shRNA Bacterial Glycerol Stock
ACTR3B pseudogene 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032412.1-97s1c1
Sequence:CCGGGAGGTACTAGCCTTGGAAGTACTCGAGTACTTCCAAGGCTAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032412.1-420s1c1
Sequence:CCGGGAAACAGTACACAGGTATCAACTCGAGTTGATACCTGTGTACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-780s1c1
Sequence:CCGGGCCTTATGGTTTGGAAGCTTACTCGAGTAAGCTTCCAAACCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-807s1c1
Sequence:CCGGGCCTCAACTCTGGAGTTATTTCTCGAGAAATAACTCCAGAGTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032412.1-107s1c1
Sequence:CCGGCCTTGGAAGTATCTTGGACATCTCGAGATGTCCAAGATACTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-770s1c1
Sequence:CCGGGCAGCACTATGCCTTATGGTTCTCGAGAACCATAAGGCATAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032412.1-403s1c1
Sequence:CCGGGATCCCTGGAAGTGGATGAAACTCGAGTTTCATCCACTTCCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032412
ACTR3BP2 MISSION shRNA shRNA Plasmid DNA
ACTR3B pseudogene 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032412.1-97s1c1
Sequence:CCGGGAGGTACTAGCCTTGGAAGTACTCGAGTACTTCCAAGGCTAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032412.1-420s1c1
Sequence:CCGGGAAACAGTACACAGGTATCAACTCGAGTTGATACCTGTGTACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-780s1c1
Sequence:CCGGGCCTTATGGTTTGGAAGCTTACTCGAGTAAGCTTCCAAACCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-807s1c1
Sequence:CCGGGCCTCAACTCTGGAGTTATTTCTCGAGAAATAACTCCAGAGTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032412.1-107s1c1
Sequence:CCGGCCTTGGAAGTATCTTGGACATCTCGAGATGTCCAAGATACTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-770s1c1
Sequence:CCGGGCAGCACTATGCCTTATGGTTCTCGAGAACCATAAGGCATAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032412.1-403s1c1
Sequence:CCGGGATCCCTGGAAGTGGATGAAACTCGAGTTTCATCCACTTCCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032412
ACTR3BP2 MISSION shRNA Lentiviral Transduction Particles
ACTR3B pseudogene 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032412.1-97s1c1
Sequence:CCGGGAGGTACTAGCCTTGGAAGTACTCGAGTACTTCCAAGGCTAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032412.1-420s1c1
Sequence:CCGGGAAACAGTACACAGGTATCAACTCGAGTTGATACCTGTGTACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-780s1c1
Sequence:CCGGGCCTTATGGTTTGGAAGCTTACTCGAGTAAGCTTCCAAACCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-807s1c1
Sequence:CCGGGCCTCAACTCTGGAGTTATTTCTCGAGAAATAACTCCAGAGTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032412.1-107s1c1
Sequence:CCGGCCTTGGAAGTATCTTGGACATCTCGAGATGTCCAAGATACTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032412.1-770s1c1
Sequence:CCGGGCAGCACTATGCCTTATGGTTCTCGAGAACCATAAGGCATAGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032412.1-403s1c1
Sequence:CCGGGATCCCTGGAAGTGGATGAAACTCGAGTTTCATCCACTTCCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks