EMAIL THIS PAGE TO A FRIEND

ACTR5

ARP5 actin-related protein 5 homolog (yeast)

45 Gene Product Result for
Synonyms: Arp5 INO80M
UniProtKB ID: Q9H9F9, Q86WF7, Q8IUY5, Q8N724, Q9BRN0, Q9BVB7
Gene ID:
Mouse(109275) ARP5 actin-related protein 5
Rat(362258) ARP5 actin-related protein 5 homolog (yeast)
Zebrafish(406809) ARP5 actin-related protein 5 homolog
dog(477227) ARP5 actin-related protein 5 homolog (yeast)
cow(100297865) ARP5 actin-related protein 5 homolog (yeast)
domestic cat(101094169) ARP5 actin-related protein 5 homolog (yeast)
chicken(419169) ARP5 actin-related protein 5 homolog (yeast)
sheep(101105517) ARP5 actin-related protein 5 homolog (yeast)
Domestic Rabbit(100339889) ARP5 actin-related protein 5 homolog (yeast)
naked mole-rat(101724536) ARP5 actin-related protein 5 homolog (yeast)
domestic guinea pig(100715875) ARP5 actin-related protein 5 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024855 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024855 Rosetta Predictions human pricing
NM_001108600 Rosetta Predictions rat pricing
NM_175419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357434 predicted 1518
2 SASI_Hs01_00091697 predicted 1302
3 SASI_Hs01_00091698 predicted 611
4 SASI_Hs01_00091699 predicted 456
5 SASI_Hs02_00357435 predicted 1520
6 SASI_Hs01_00091701 predicted 765
7 SASI_Hs01_00091702 predicted 397
8 SASI_Hs01_00091703 predicted 679
9 SASI_Hs01_00091706 predicted 1466
10 SASI_Hs01_00091704 predicted 1001
11 SASI_Hs01_00091700 predicted 1920
12 SASI_Hs01_00091705 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240239 predicted 1209
2 SASI_Rn02_00240240 predicted 1647
3 SASI_Rn02_00240241 predicted 860
4 SASI_Rn02_00240242 predicted 1284
5 SASI_Rn02_00240243 predicted 1704
6 SASI_Rn02_00240244 predicted 942
7 SASI_Rn02_00240245 predicted 779
8 SASI_Rn02_00240246 predicted 767
9 SASI_Rn02_00240247 predicted 1712
10 SASI_Rn02_00240248 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123142 predicted 2064
2 SASI_Mm01_00123143 predicted 1238
3 SASI_Mm01_00123144 predicted 1514
4 SASI_Mm01_00123145 predicted 776
5 SASI_Mm01_00123146 predicted 1458
6 SASI_Mm01_00123147 predicted 1285
7 SASI_Mm01_00123148 predicted 1841
8 SASI_Mm01_00123149 predicted 1715
9 SASI_Mm01_00123150 predicted 947
10 SASI_Mm01_00123151 predicted 1728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024855
VALIDATED
ACTR5 MISSION shRNA Bacterial Glycerol Stock
ARP5 actin-related protein 5 homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024855.2-2066s1c1
Sequence:CCGGCCTTCTGATGTCTTTGTTCAACTCGAGTTGAACAAAGACATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1337s1c1
Sequence:CCGGGCATATCATCAGCTATTTGTTCTCGAGAACAAATAGCTGATGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1430s1c1
Sequence:CCGGGCAGAGACTCTCCAGTACATTCTCGAGAATGTACTGGAGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1646s1c1
Sequence:CCGGGCCTTGAACCACCTAGATGATCTCGAGATCATCTAGGTGGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024855.2-445s1c1
Sequence:CCGGCCCACTGTATTCACGGCAAATCTCGAGATTTGCCGTGAATACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-992s21c1
Sequence:CCGGCGTCTGGACCGACTGCTATATCTCGAGATATAGCAGTCGGTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-774s21c1
Sequence:CCGGGCTACATCGCTGAGGATTATGCTCGAGCATAATCCTCAGCGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-1518s21c1
Sequence:CCGGCGATGTATCCTGGCATGAAAGCTCGAGCTTTCATGCCAGGATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-845s21c1
Sequence:CCGGCACAAGATGCAGCTCCCATTTCTCGAGAAATGGGAGCTGCATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024855.3-2166s21c1
Sequence:CCGGGACTGATTTCTTACCACATTTCTCGAGAAATGTGGTAAGAAATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024855
VALIDATED
ACTR5 MISSION shRNA shRNA Plasmid DNA
ARP5 actin-related protein 5 homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024855.2-2066s1c1
Sequence:CCGGCCTTCTGATGTCTTTGTTCAACTCGAGTTGAACAAAGACATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1337s1c1
Sequence:CCGGGCATATCATCAGCTATTTGTTCTCGAGAACAAATAGCTGATGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1430s1c1
Sequence:CCGGGCAGAGACTCTCCAGTACATTCTCGAGAATGTACTGGAGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1646s1c1
Sequence:CCGGGCCTTGAACCACCTAGATGATCTCGAGATCATCTAGGTGGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024855.2-445s1c1
Sequence:CCGGCCCACTGTATTCACGGCAAATCTCGAGATTTGCCGTGAATACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-992s21c1
Sequence:CCGGCGTCTGGACCGACTGCTATATCTCGAGATATAGCAGTCGGTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-774s21c1
Sequence:CCGGGCTACATCGCTGAGGATTATGCTCGAGCATAATCCTCAGCGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-1518s21c1
Sequence:CCGGCGATGTATCCTGGCATGAAAGCTCGAGCTTTCATGCCAGGATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-845s21c1
Sequence:CCGGCACAAGATGCAGCTCCCATTTCTCGAGAAATGGGAGCTGCATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024855.3-2166s21c1
Sequence:CCGGGACTGATTTCTTACCACATTTCTCGAGAAATGTGGTAAGAAATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024855
VALIDATED
ACTR5 MISSION shRNA Lentiviral Transduction Particles
ARP5 actin-related protein 5 homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024855.2-2066s1c1
Sequence:CCGGCCTTCTGATGTCTTTGTTCAACTCGAGTTGAACAAAGACATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1337s1c1
Sequence:CCGGGCATATCATCAGCTATTTGTTCTCGAGAACAAATAGCTGATGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1430s1c1
Sequence:CCGGGCAGAGACTCTCCAGTACATTCTCGAGAATGTACTGGAGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024855.2-1646s1c1
Sequence:CCGGGCCTTGAACCACCTAGATGATCTCGAGATCATCTAGGTGGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024855.2-445s1c1
Sequence:CCGGCCCACTGTATTCACGGCAAATCTCGAGATTTGCCGTGAATACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-992s21c1
Sequence:CCGGCGTCTGGACCGACTGCTATATCTCGAGATATAGCAGTCGGTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-774s21c1
Sequence:CCGGGCTACATCGCTGAGGATTATGCTCGAGCATAATCCTCAGCGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-1518s21c1
Sequence:CCGGCGATGTATCCTGGCATGAAAGCTCGAGCTTTCATGCCAGGATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024855.3-845s21c1
Sequence:CCGGCACAAGATGCAGCTCCCATTTCTCGAGAAATGGGAGCTGCATCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024855.3-2166s21c1
Sequence:CCGGGACTGATTTCTTACCACATTTCTCGAGAAATGTGGTAAGAAATCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175419
VALIDATED
ACTR5 MISSION shRNA Bacterial Glycerol Stock
ARP5 actin-related protein 5 homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175419.3-2090s1c1
Sequence:CCGGCGTGTTTAACTTGGCAGCGTACTCGAGTACGCTGCCAAGTTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-838s1c1
Sequence:CCGGCGCATCAATCTTGGAGGAAGTCTCGAGACTTCCTCCAAGATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-1434s1c1
Sequence:CCGGCATCAGTGATTTCGAGCCTTTCTCGAGAAAGGCTCGAAATCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-759s1c1
Sequence:CCGGCCTCATCATTTCATCCGGCTACTCGAGTAGCCGGATGAAATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-1006s1c1
Sequence:CCGGCCCGATTACTACGAGAACAATCTCGAGATTGTTCTCGTAGTAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175419
VALIDATED
ACTR5 MISSION shRNA shRNA Plasmid DNA
ARP5 actin-related protein 5 homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175419.3-2090s1c1
Sequence:CCGGCGTGTTTAACTTGGCAGCGTACTCGAGTACGCTGCCAAGTTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-838s1c1
Sequence:CCGGCGCATCAATCTTGGAGGAAGTCTCGAGACTTCCTCCAAGATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-1434s1c1
Sequence:CCGGCATCAGTGATTTCGAGCCTTTCTCGAGAAAGGCTCGAAATCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-759s1c1
Sequence:CCGGCCTCATCATTTCATCCGGCTACTCGAGTAGCCGGATGAAATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-1006s1c1
Sequence:CCGGCCCGATTACTACGAGAACAATCTCGAGATTGTTCTCGTAGTAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175419
VALIDATED
ACTR5 MISSION shRNA Lentiviral Transduction Particles
ARP5 actin-related protein 5 homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175419.3-2090s1c1
Sequence:CCGGCGTGTTTAACTTGGCAGCGTACTCGAGTACGCTGCCAAGTTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-838s1c1
Sequence:CCGGCGCATCAATCTTGGAGGAAGTCTCGAGACTTCCTCCAAGATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-1434s1c1
Sequence:CCGGCATCAGTGATTTCGAGCCTTTCTCGAGAAAGGCTCGAAATCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-759s1c1
Sequence:CCGGCCTCATCATTTCATCCGGCTACTCGAGTAGCCGGATGAAATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175419.3-1006s1c1
Sequence:CCGGCCCGATTACTACGAGAACAATCTCGAGATTGTTCTCGTAGTAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks