EMAIL THIS PAGE TO A FRIEND

ACTR6

ARP6 actin-related protein 6 homolog (yeast)

63 Gene Product Result for
Synonyms: ARP6 HSPC281 MSTP136 hARP6 hARPX
UniProtKB ID: Q9GZN1, B3KW37, Q9BY39, Q9H8H6
Gene ID:
Mouse(67019) ARP6 actin-related protein 6
Rat(314718) ARP6 actin-related protein 6 homolog (yeast)
domestic guinea pig(100714600) ARP6 actin-related protein 6 homolog (yeast)
naked mole-rat(101717737) ARP6 actin-related protein 6 homolog (yeast)
sheep(101104475) ARP6 actin-related protein 6 homolog (yeast)
Domestic Rabbit(100338560) ARP6 actin-related protein 6 homolog (yeast)
Zebrafish(324822) ARP6 actin-related protein 6 homolog (yeast)
chicken(395348) ARP6 actin-related protein 6 homolog (yeast)
cow(613596) ARP6 actin-related protein 6 homolog (yeast)
Horse(100052662) ARP6 actin-related protein 6 homolog (yeast)
domestic cat(101096327) ARP6 actin-related protein 6 homolog (yeast)
dog(475439) ARP6 actin-related protein 6 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022496 Rosetta Predictions human pricing
NM_001108081 Rosetta Predictions rat pricing
NM_025914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355816 predicted 643
2 SASI_Hs01_00055033 predicted 637
3 SASI_Hs01_00055034 predicted 1043
4 SASI_Hs02_00355817 predicted 244
5 SASI_Hs01_00055035 predicted 678
6 SASI_Hs01_00055036 predicted 855
7 SASI_Hs02_00355818 predicted 1065
8 SASI_Hs02_00355819 predicted 701
9 SASI_Hs02_00355820 predicted 568
10 SASI_Hs02_00355821 predicted 741
11 SASI_Hs01_00055032 predicted 973
12 SASI_Hs01_00055037 predicted 493
13 SASI_Hs01_00055038 predicted 266
14 SASI_Hs01_00055039 predicted 453
15 SASI_Hs01_00055040 predicted 510
16 SASI_Hs01_00055041 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235164 predicted 1137
2 SASI_Rn02_00235165 predicted 365
3 SASI_Rn02_00235166 predicted 440
4 SASI_Rn02_00235167 predicted 519
5 SASI_Rn02_00235168 predicted 268
6 SASI_Rn02_00235169 predicted 751
7 SASI_Rn02_00235170 predicted 378
8 SASI_Rn02_00235171 predicted 448
9 SASI_Rn02_00235172 predicted 937
10 SASI_Rn02_00235173 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165864 predicted 1334
2 SASI_Mm01_00165865 predicted 939
3 SASI_Mm01_00165866 predicted 1080
4 SASI_Mm01_00165867 predicted 746
5 SASI_Mm01_00165868 predicted 324
6 SASI_Mm01_00165869 predicted 644
7 SASI_Mm01_00165870 predicted 381
8 SASI_Mm01_00165871 predicted 264
9 SASI_Mm01_00165872 predicted 1029
10 SASI_Mm01_00165873 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025914
VALIDATED
ACTR6 MISSION shRNA Bacterial Glycerol Stock
ARP6 actin-related protein 6 homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-518s21c1
Sequence:CCGGCGCACATTGTTCCTTACTGTACTCGAGTACAGTAAGGAACAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025914.2-1420s21c1
Sequence:CCGGCCGTGGTTCATTACTTAGTTACTCGAGTAACTAAGTAATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-768s21c1
Sequence:CCGGGCCTGACTTCAGCACAATTAACTCGAGTTAATTGTGCTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-943s21c1
Sequence:CCGGGCCATTGTCTATTCAATCCAACTCGAGTTGGATTGAATAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025914.1-1421s1c1
Sequence:CCGGCCGTGGTTCATTACTTAGTTACTCGAGTAACTAAGTAATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-519s1c1
Sequence:CCGGCGCACATTGTTCCTTACTGTACTCGAGTACAGTAAGGAACAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025914.1-769s1c1
Sequence:CCGGGCCTGACTTCAGCACAATTAACTCGAGTTAATTGTGCTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-944s1c1
Sequence:CCGGGCCATTGTCTATTCAATCCAACTCGAGTTGGATTGAATAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-412s1c1
Sequence:CCGGCCAAGCAGTATTAAGAGTAAACTCGAGTTTACTCTTAATACTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025914
VALIDATED
ACTR6 MISSION shRNA shRNA Plasmid DNA
ARP6 actin-related protein 6 homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-518s21c1
Sequence:CCGGCGCACATTGTTCCTTACTGTACTCGAGTACAGTAAGGAACAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025914.2-1420s21c1
Sequence:CCGGCCGTGGTTCATTACTTAGTTACTCGAGTAACTAAGTAATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-768s21c1
Sequence:CCGGGCCTGACTTCAGCACAATTAACTCGAGTTAATTGTGCTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-943s21c1
Sequence:CCGGGCCATTGTCTATTCAATCCAACTCGAGTTGGATTGAATAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025914.1-1421s1c1
Sequence:CCGGCCGTGGTTCATTACTTAGTTACTCGAGTAACTAAGTAATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-519s1c1
Sequence:CCGGCGCACATTGTTCCTTACTGTACTCGAGTACAGTAAGGAACAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025914.1-769s1c1
Sequence:CCGGGCCTGACTTCAGCACAATTAACTCGAGTTAATTGTGCTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-944s1c1
Sequence:CCGGGCCATTGTCTATTCAATCCAACTCGAGTTGGATTGAATAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-412s1c1
Sequence:CCGGCCAAGCAGTATTAAGAGTAAACTCGAGTTTACTCTTAATACTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025914
VALIDATED
ACTR6 MISSION shRNA Lentiviral Transduction Particles
ARP6 actin-related protein 6 homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-518s21c1
Sequence:CCGGCGCACATTGTTCCTTACTGTACTCGAGTACAGTAAGGAACAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025914.2-1420s21c1
Sequence:CCGGCCGTGGTTCATTACTTAGTTACTCGAGTAACTAAGTAATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-768s21c1
Sequence:CCGGGCCTGACTTCAGCACAATTAACTCGAGTTAATTGTGCTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025914.2-943s21c1
Sequence:CCGGGCCATTGTCTATTCAATCCAACTCGAGTTGGATTGAATAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025914.1-1421s1c1
Sequence:CCGGCCGTGGTTCATTACTTAGTTACTCGAGTAACTAAGTAATGAACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-519s1c1
Sequence:CCGGCGCACATTGTTCCTTACTGTACTCGAGTACAGTAAGGAACAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025914.1-769s1c1
Sequence:CCGGGCCTGACTTCAGCACAATTAACTCGAGTTAATTGTGCTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-944s1c1
Sequence:CCGGGCCATTGTCTATTCAATCCAACTCGAGTTGGATTGAATAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025914.1-412s1c1
Sequence:CCGGCCAAGCAGTATTAAGAGTAAACTCGAGTTTACTCTTAATACTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022496
VALIDATED
ACTR6 MISSION shRNA Bacterial Glycerol Stock
ARP6 actin-related protein 6 homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-770s21c1
Sequence:CCGGGCCTGACTTCAGTACAATTAACTCGAGTTAATTGTACTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-906s21c1
Sequence:CCGGCCTTCTGATATAGGCATTCAACTCGAGTTGAATGCCTATATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-464s21c1
Sequence:CCGGCCGAGATAATCCTTCCGAATTCTCGAGAATTCGGAAGGATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-450s21c1
Sequence:CCGGGCACATAGGTATTTCCGAGATCTCGAGATCTCGGAAATACCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022496.3-1474s21c1
Sequence:CCGGGCTGTTTCCAAGGGTAGGTTACTCGAGTAACCTACCCTTGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-454s1c1
Sequence:CCGGGCACATAGGTATTTCCGAGATCTCGAGATCTCGGAAATACCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-1478s1c1
Sequence:CCGGGCTGTTTCCAAGGGTAGGTTACTCGAGTAACCTACCCTTGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-774s1c1
Sequence:CCGGGCCTGACTTCAGTACAATTAACTCGAGTTAATTGTACTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-468s1c1
Sequence:CCGGCCGAGATAATCCTTCCGAATTCTCGAGAATTCGGAAGGATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-910s1c1
Sequence:CCGGCCTTCTGATATAGGCATTCAACTCGAGTTGAATGCCTATATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022496
VALIDATED
ACTR6 MISSION shRNA shRNA Plasmid DNA
ARP6 actin-related protein 6 homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-770s21c1
Sequence:CCGGGCCTGACTTCAGTACAATTAACTCGAGTTAATTGTACTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-906s21c1
Sequence:CCGGCCTTCTGATATAGGCATTCAACTCGAGTTGAATGCCTATATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-464s21c1
Sequence:CCGGCCGAGATAATCCTTCCGAATTCTCGAGAATTCGGAAGGATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-450s21c1
Sequence:CCGGGCACATAGGTATTTCCGAGATCTCGAGATCTCGGAAATACCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022496.3-1474s21c1
Sequence:CCGGGCTGTTTCCAAGGGTAGGTTACTCGAGTAACCTACCCTTGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-454s1c1
Sequence:CCGGGCACATAGGTATTTCCGAGATCTCGAGATCTCGGAAATACCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-1478s1c1
Sequence:CCGGGCTGTTTCCAAGGGTAGGTTACTCGAGTAACCTACCCTTGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-774s1c1
Sequence:CCGGGCCTGACTTCAGTACAATTAACTCGAGTTAATTGTACTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-468s1c1
Sequence:CCGGCCGAGATAATCCTTCCGAATTCTCGAGAATTCGGAAGGATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-910s1c1
Sequence:CCGGCCTTCTGATATAGGCATTCAACTCGAGTTGAATGCCTATATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022496
VALIDATED
ACTR6 MISSION shRNA Lentiviral Transduction Particles
ARP6 actin-related protein 6 homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-770s21c1
Sequence:CCGGGCCTGACTTCAGTACAATTAACTCGAGTTAATTGTACTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-906s21c1
Sequence:CCGGCCTTCTGATATAGGCATTCAACTCGAGTTGAATGCCTATATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-464s21c1
Sequence:CCGGCCGAGATAATCCTTCCGAATTCTCGAGAATTCGGAAGGATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022496.3-450s21c1
Sequence:CCGGGCACATAGGTATTTCCGAGATCTCGAGATCTCGGAAATACCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022496.3-1474s21c1
Sequence:CCGGGCTGTTTCCAAGGGTAGGTTACTCGAGTAACCTACCCTTGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-454s1c1
Sequence:CCGGGCACATAGGTATTTCCGAGATCTCGAGATCTCGGAAATACCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-1478s1c1
Sequence:CCGGGCTGTTTCCAAGGGTAGGTTACTCGAGTAACCTACCCTTGGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-774s1c1
Sequence:CCGGGCCTGACTTCAGTACAATTAACTCGAGTTAATTGTACTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-468s1c1
Sequence:CCGGCCGAGATAATCCTTCCGAATTCTCGAGAATTCGGAAGGATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_022496.2-910s1c1
Sequence:CCGGCCTTCTGATATAGGCATTCAACTCGAGTTGAATGCCTATATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks