EMAIL THIS PAGE TO A FRIEND

ACTR8

ARP8 actin-related protein 8 homolog (yeast)

64 Gene Product Result for
Synonyms: ARP8 INO80N hArp8
UniProtKB ID: Q9H981, B3KSW7, Q8N566, Q9H663
Gene ID:
Mouse(56249) ARP8 actin-related protein 8
Rat(361107) ARP8 actin-related protein 8 homolog (yeast)
Zebrafish(326866) ARP8 actin-related protein 8 homolog (yeast)
cow(615133) ARP8 actin-related protein 8 homolog (yeast)
dog(607274) ARP8 actin-related protein 8 homolog (yeast)
domestic cat(101094165) ARP8 actin-related protein 8 homolog (yeast)
chicken(415994) ARP8 actin-related protein 8 homolog (yeast)
sheep(101110005) ARP8 actin-related protein 8 homolog (yeast)
naked mole-rat(101713560) ARP8 actin-related protein 8 homolog (yeast)
domestic guinea pig(100725709) ARP8 actin-related protein 8 homolog (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022899 Rosetta Predictions human pricing
NM_001108396 Rosetta Predictions rat pricing
NM_027493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091605 predicted 543
2 SASI_Hs01_00091606 predicted 1272
3 SASI_Hs01_00091607 predicted 393
4 SASI_Hs01_00091608 predicted 616
5 SASI_Hs01_00091609 predicted 1345
6 SASI_Hs01_00091610 predicted 1648
7 SASI_Hs01_00091611 predicted 1821
8 SASI_Hs01_00091612 predicted 830
9 SASI_Hs01_00091613 predicted 866
10 SASI_Hs01_00091614 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238249 predicted 568
2 SASI_Rn02_00238250 predicted 636
3 SASI_Rn02_00238251 predicted 421
4 SASI_Rn02_00238252 predicted 454
5 SASI_Rn02_00238253 predicted 518
6 SASI_Rn02_00238254 predicted 631
7 SASI_Rn02_00238255 predicted 516
8 SASI_Rn02_00238256 predicted 402
9 SASI_Rn02_00238257 predicted 575
10 SASI_Rn02_00238258 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177478 predicted 1461
2 SASI_Mm01_00177480 predicted 1556
3 SASI_Mm01_00177481 predicted 860
4 SASI_Mm01_00177482 predicted 271
5 SASI_Mm01_00177483 predicted 1204
6 SASI_Mm02_00332320 predicted 278
7 SASI_Mm01_00177484 predicted 1175
8 SASI_Mm01_00177485 predicted 331
9 SASI_Mm01_00177486 predicted 900
10 SASI_Mm01_00177487 predicted 1327
11 SASI_Mm01_00177479 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022899
VALIDATED
ACTR8 MISSION shRNA Bacterial Glycerol Stock
ARP8 actin-related protein 8 homolog (yeast)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-955s1c1
Sequence:CCGGCTCATCGGAATACTCGGCTTTCTCGAGAAAGCCGAGTATTCCGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1392s1c1
Sequence:CCGGGCATCCAAACCTATTGGATTTCTCGAGAAATCCAATAGGTTTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022899.3-3101s1c1
Sequence:CCGGGATGGAAATCAGAAGGGAATACTCGAGTATTCCCTTCTGATTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022899.3-1040s1c1
Sequence:CCGGCCCTTACAGAGAATGCCAGTTCTCGAGAACTGGCATTCTCTGTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1740s1c1
Sequence:CCGGCCATCCTTCAGGCGAATTATTCTCGAGAATAATTCGCCTGAAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022899.3-1182s1c1
Sequence:CCGGCTGCTTTACCAGTTTCGATTACTCGAGTAATCGAAACTGGTAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1675s1c1
Sequence:CCGGGAGGTGGTTTGATGTTTCATACTCGAGTATGAAACATCAAACCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1181s1c1
Sequence:CCGGCCTGCTTTACCAGTTTCGATTCTCGAGAATCGAAACTGGTAAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-399s21c1
Sequence:CCGGGATCAAGCAATATGGTCTAAACTCGAGTTTAGACCATATTGCTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-1310s21c1
Sequence:CCGGGGATCCTCACGATGAACATTACTCGAGTAATGTTCATCGTGAGGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022899.3-2355s21c1
Sequence:CCGGGTATTTCATTAGGATCTAAAGCTCGAGCTTTAGATCCTAATGAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-502s21c1
Sequence:CCGGTAGATCACTGTTCGGGAAATACTCGAGTATTTCCCGAACAGTGATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-585s21c1
Sequence:CCGGCCACTGGACTGTTACAATATTCTCGAGAATATTGTAACAGTCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022899.3-2202s21c1
Sequence:CCGGAGTGATGTAAACGTTGCTATTCTCGAGAATAGCAACGTTTACATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022899
VALIDATED
ACTR8 MISSION shRNA shRNA Plasmid DNA
ARP8 actin-related protein 8 homolog (yeast)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-955s1c1
Sequence:CCGGCTCATCGGAATACTCGGCTTTCTCGAGAAAGCCGAGTATTCCGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1392s1c1
Sequence:CCGGGCATCCAAACCTATTGGATTTCTCGAGAAATCCAATAGGTTTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022899.3-3101s1c1
Sequence:CCGGGATGGAAATCAGAAGGGAATACTCGAGTATTCCCTTCTGATTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022899.3-1040s1c1
Sequence:CCGGCCCTTACAGAGAATGCCAGTTCTCGAGAACTGGCATTCTCTGTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1740s1c1
Sequence:CCGGCCATCCTTCAGGCGAATTATTCTCGAGAATAATTCGCCTGAAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022899.3-1182s1c1
Sequence:CCGGCTGCTTTACCAGTTTCGATTACTCGAGTAATCGAAACTGGTAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1675s1c1
Sequence:CCGGGAGGTGGTTTGATGTTTCATACTCGAGTATGAAACATCAAACCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1181s1c1
Sequence:CCGGCCTGCTTTACCAGTTTCGATTCTCGAGAATCGAAACTGGTAAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-399s21c1
Sequence:CCGGGATCAAGCAATATGGTCTAAACTCGAGTTTAGACCATATTGCTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-1310s21c1
Sequence:CCGGGGATCCTCACGATGAACATTACTCGAGTAATGTTCATCGTGAGGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022899.3-2355s21c1
Sequence:CCGGGTATTTCATTAGGATCTAAAGCTCGAGCTTTAGATCCTAATGAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-502s21c1
Sequence:CCGGTAGATCACTGTTCGGGAAATACTCGAGTATTTCCCGAACAGTGATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-585s21c1
Sequence:CCGGCCACTGGACTGTTACAATATTCTCGAGAATATTGTAACAGTCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022899.3-2202s21c1
Sequence:CCGGAGTGATGTAAACGTTGCTATTCTCGAGAATAGCAACGTTTACATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022899
VALIDATED
ACTR8 MISSION shRNA Lentiviral Transduction Particles
ARP8 actin-related protein 8 homolog (yeast)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-955s1c1
Sequence:CCGGCTCATCGGAATACTCGGCTTTCTCGAGAAAGCCGAGTATTCCGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1392s1c1
Sequence:CCGGGCATCCAAACCTATTGGATTTCTCGAGAAATCCAATAGGTTTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022899.3-3101s1c1
Sequence:CCGGGATGGAAATCAGAAGGGAATACTCGAGTATTCCCTTCTGATTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022899.3-1040s1c1
Sequence:CCGGCCCTTACAGAGAATGCCAGTTCTCGAGAACTGGCATTCTCTGTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1740s1c1
Sequence:CCGGCCATCCTTCAGGCGAATTATTCTCGAGAATAATTCGCCTGAAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022899.3-1182s1c1
Sequence:CCGGCTGCTTTACCAGTTTCGATTACTCGAGTAATCGAAACTGGTAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1675s1c1
Sequence:CCGGGAGGTGGTTTGATGTTTCATACTCGAGTATGAAACATCAAACCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022899.3-1181s1c1
Sequence:CCGGCCTGCTTTACCAGTTTCGATTCTCGAGAATCGAAACTGGTAAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-399s21c1
Sequence:CCGGGATCAAGCAATATGGTCTAAACTCGAGTTTAGACCATATTGCTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-1310s21c1
Sequence:CCGGGGATCCTCACGATGAACATTACTCGAGTAATGTTCATCGTGAGGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022899.3-2355s21c1
Sequence:CCGGGTATTTCATTAGGATCTAAAGCTCGAGCTTTAGATCCTAATGAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-502s21c1
Sequence:CCGGTAGATCACTGTTCGGGAAATACTCGAGTATTTCCCGAACAGTGATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022899.3-585s21c1
Sequence:CCGGCCACTGGACTGTTACAATATTCTCGAGAATATTGTAACAGTCCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022899.3-2202s21c1
Sequence:CCGGAGTGATGTAAACGTTGCTATTCTCGAGAATAGCAACGTTTACATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027493
VALIDATED
ACTR8 MISSION shRNA Bacterial Glycerol Stock
ARP8 actin-related protein 8 homolog (yeast)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.1-741s1c1
Sequence:CCGGGAAATCCCACTGAAAGATTTACTCGAGTAAATCTTTCAGTGGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-567s1c1
Sequence:CCGGCCTGAGTATTTGGTAGGAGAACTCGAGTTCTCCTACCAAATACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-209s1c1
Sequence:CCGGCCAGAGCAACTTCATTGTTGTCTCGAGACAACAATGAAGTTGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-1413s1c1
Sequence:CCGGGCATCCAAACCCATTGGATTTCTCGAGAAATCCAATGGGTTTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027493.1-1871s1c1
Sequence:CCGGCACTCAGGAACTGTGGATTTACTCGAGTAAATCCACAGTTCCTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-1252s1c1
Sequence:CCGGCTGCTTTACCAGTTTCGATTACTCGAGTAATCGAAACTGGTAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-825s1c1
Sequence:CCGGCATCTTGTTAATTCCAGATATCTCGAGATATCTGGAATTAACAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-469s1c1
Sequence:CCGGGACCAGGCAATATGGTCTAAACTCGAGTTTAGACCATATTGCCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-404s21c1
Sequence:CCGGTCCTAAGGGAAGGACTAAATACTCGAGTATTTAGTCCTTCCCTTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-1253s21c1
Sequence:CCGGTGCTTTACCAGTTTCGATTAGCTCGAGCTAATCGAAACTGGTAAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-1119s21c1
Sequence:CCGGAGAGTGTCAGCTGACAAATAACTCGAGTTATTTGTCAGCTGACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027493.3-1809s21c1
Sequence:CCGGGCCTTCATTCAGGCGAATTATCTCGAGATAATTCGCCTGAATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027493.3-258s21c1
Sequence:CCGGCCAGAGCAACTTCATTGTTGTCTCGAGACAACAATGAAGTTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027493
VALIDATED
ACTR8 MISSION shRNA shRNA Plasmid DNA
ARP8 actin-related protein 8 homolog (yeast)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.1-741s1c1
Sequence:CCGGGAAATCCCACTGAAAGATTTACTCGAGTAAATCTTTCAGTGGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-567s1c1
Sequence:CCGGCCTGAGTATTTGGTAGGAGAACTCGAGTTCTCCTACCAAATACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-209s1c1
Sequence:CCGGCCAGAGCAACTTCATTGTTGTCTCGAGACAACAATGAAGTTGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-1413s1c1
Sequence:CCGGGCATCCAAACCCATTGGATTTCTCGAGAAATCCAATGGGTTTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027493.1-1871s1c1
Sequence:CCGGCACTCAGGAACTGTGGATTTACTCGAGTAAATCCACAGTTCCTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-1252s1c1
Sequence:CCGGCTGCTTTACCAGTTTCGATTACTCGAGTAATCGAAACTGGTAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-825s1c1
Sequence:CCGGCATCTTGTTAATTCCAGATATCTCGAGATATCTGGAATTAACAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-469s1c1
Sequence:CCGGGACCAGGCAATATGGTCTAAACTCGAGTTTAGACCATATTGCCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-404s21c1
Sequence:CCGGTCCTAAGGGAAGGACTAAATACTCGAGTATTTAGTCCTTCCCTTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-1253s21c1
Sequence:CCGGTGCTTTACCAGTTTCGATTAGCTCGAGCTAATCGAAACTGGTAAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-1119s21c1
Sequence:CCGGAGAGTGTCAGCTGACAAATAACTCGAGTTATTTGTCAGCTGACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027493.3-1809s21c1
Sequence:CCGGGCCTTCATTCAGGCGAATTATCTCGAGATAATTCGCCTGAATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027493.3-258s21c1
Sequence:CCGGCCAGAGCAACTTCATTGTTGTCTCGAGACAACAATGAAGTTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027493
VALIDATED
ACTR8 MISSION shRNA Lentiviral Transduction Particles
ARP8 actin-related protein 8 homolog (yeast)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.1-741s1c1
Sequence:CCGGGAAATCCCACTGAAAGATTTACTCGAGTAAATCTTTCAGTGGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-567s1c1
Sequence:CCGGCCTGAGTATTTGGTAGGAGAACTCGAGTTCTCCTACCAAATACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-209s1c1
Sequence:CCGGCCAGAGCAACTTCATTGTTGTCTCGAGACAACAATGAAGTTGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027493.1-1413s1c1
Sequence:CCGGGCATCCAAACCCATTGGATTTCTCGAGAAATCCAATGGGTTTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027493.1-1871s1c1
Sequence:CCGGCACTCAGGAACTGTGGATTTACTCGAGTAAATCCACAGTTCCTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-1252s1c1
Sequence:CCGGCTGCTTTACCAGTTTCGATTACTCGAGTAATCGAAACTGGTAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-825s1c1
Sequence:CCGGCATCTTGTTAATTCCAGATATCTCGAGATATCTGGAATTAACAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027493.3-469s1c1
Sequence:CCGGGACCAGGCAATATGGTCTAAACTCGAGTTTAGACCATATTGCCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-404s21c1
Sequence:CCGGTCCTAAGGGAAGGACTAAATACTCGAGTATTTAGTCCTTCCCTTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-1253s21c1
Sequence:CCGGTGCTTTACCAGTTTCGATTAGCTCGAGCTAATCGAAACTGGTAAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027493.3-1119s21c1
Sequence:CCGGAGAGTGTCAGCTGACAAATAACTCGAGTTATTTGTCAGCTGACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027493.3-1809s21c1
Sequence:CCGGGCCTTCATTCAGGCGAATTATCTCGAGATAATTCGCCTGAATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027493.3-258s21c1
Sequence:CCGGCCAGAGCAACTTCATTGTTGTCTCGAGACAACAATGAAGTTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)