EMAIL THIS PAGE TO A FRIEND

ACTRT1

actin-related protein T1

47 Gene Product Result for
Synonyms: AIP1 ARIP1 ARPT1 HSD27
UniProtKB ID: Q8TDG2, Q6X7C1, Q96L10
Gene ID:
Human(139741) Summary: This gene encodes a protein related to the cytoskeletal protein beta-actin. This protein is a major component of the calyx in the perinuclear theca of mammalian sperm heads, and it therefore likely functions in spermatid formation. This gene is intronless and is similar to a related gene located on chromosome 1. A related pseudogene has also been identified approximately 75 kb downstream of this gene on chromosome X. [provided by RefSeq, May 2010]
Mouse(73360) actin-related protein T1
Rat(302796) actin-related protein T1
sheep(101119281) actin-related protein T1
chicken(428177) actin-related protein T1
dog(492120) actin-related protein T1
cow(539271) actin-related protein T1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138289 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035931 MISSION® esiRNA esiRNA human ACTRT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138289 Rosetta Predictions human pricing
NM_001013961 Rosetta Predictions rat pricing
NM_028514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093839 predicted 788
2 SASI_Hs01_00093840 predicted 410
3 SASI_Hs01_00093841 predicted 769
4 SASI_Hs02_00363377 predicted 1050
5 SASI_Hs01_00093842 predicted 868
6 SASI_Hs01_00093843 predicted 504
7 SASI_Hs01_00093844 predicted 1170
8 SASI_Hs01_00093845 predicted 323
9 SASI_Hs01_00093846 predicted 360
10 SASI_Hs01_00093847 predicted 801
11 SASI_Hs01_00093848 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078545 predicted 404
2 SASI_Rn01_00078546 predicted 650
3 SASI_Rn01_00078547 predicted 736
4 SASI_Rn01_00078548 predicted 329
5 SASI_Rn01_00078549 predicted 490
6 SASI_Rn01_00078550 predicted 603
7 SASI_Rn01_00078551 predicted 624
8 SASI_Rn01_00078553 predicted 351
9 SASI_Rn01_00078554 predicted 406
10 SASI_Rn02_00201286 predicted 557
11 SASI_Rn01_00078552 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064858 predicted 631
2 SASI_Mm01_00064859 predicted 970
3 SASI_Mm01_00064860 predicted 292
4 SASI_Mm01_00064861 predicted 455
5 SASI_Mm02_00333987 predicted 993
6 SASI_Mm02_00333988 predicted 530
7 SASI_Mm01_00064862 predicted 394
8 SASI_Mm01_00064863 predicted 1014
9 SASI_Mm01_00064864 predicted 727
10 SASI_Mm01_00064865 predicted 319
11 SASI_Mm01_00064866 predicted 1036
12 SASI_Mm01_00064867 predicted 1106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028514
ACTRT1 MISSION shRNA Bacterial Glycerol Stock
actin-related protein T1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-499s21c1
Sequence:CCGGCGTGCCTGCCTTGTATCTTTGCTCGAGCAAAGATACAAGGCAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-159s21c1
Sequence:CCGGGACTCTGTAAAGTTGGAATTTCTCGAGAAATTCCAACTTTACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-733s21c1
Sequence:CCGGAGCAGTGGTGGATGATATTAACTCGAGTTAATATCATCCACCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-1182s1c1
Sequence:CCGGGCTGAGGACTTCAAAGAGTATCTCGAGATACTCTTTGAAGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-282s1c1
Sequence:CCGGGAAGAAGCTCAGTGCATGTATCTCGAGATACATGCACTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-897s1c1
Sequence:CCGGCCTGACCATCTAGGTATTCATCTCGAGATGAATACCTAGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-630s1c1
Sequence:CCGGCCTCATGCTATCACCAAGCTACTCGAGTAGCTTGGTGATAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-303s1c1
Sequence:CCGGGATGGCTTATATCTACACTATCTCGAGATAGTGTAGATATAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028514
ACTRT1 MISSION shRNA shRNA Plasmid DNA
actin-related protein T1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-499s21c1
Sequence:CCGGCGTGCCTGCCTTGTATCTTTGCTCGAGCAAAGATACAAGGCAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-159s21c1
Sequence:CCGGGACTCTGTAAAGTTGGAATTTCTCGAGAAATTCCAACTTTACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-733s21c1
Sequence:CCGGAGCAGTGGTGGATGATATTAACTCGAGTTAATATCATCCACCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-1182s1c1
Sequence:CCGGGCTGAGGACTTCAAAGAGTATCTCGAGATACTCTTTGAAGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-282s1c1
Sequence:CCGGGAAGAAGCTCAGTGCATGTATCTCGAGATACATGCACTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-897s1c1
Sequence:CCGGCCTGACCATCTAGGTATTCATCTCGAGATGAATACCTAGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-630s1c1
Sequence:CCGGCCTCATGCTATCACCAAGCTACTCGAGTAGCTTGGTGATAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-303s1c1
Sequence:CCGGGATGGCTTATATCTACACTATCTCGAGATAGTGTAGATATAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028514
ACTRT1 MISSION shRNA Lentiviral Transduction Particles
actin-related protein T1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-499s21c1
Sequence:CCGGCGTGCCTGCCTTGTATCTTTGCTCGAGCAAAGATACAAGGCAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-159s21c1
Sequence:CCGGGACTCTGTAAAGTTGGAATTTCTCGAGAAATTCCAACTTTACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028514.3-733s21c1
Sequence:CCGGAGCAGTGGTGGATGATATTAACTCGAGTTAATATCATCCACCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-1182s1c1
Sequence:CCGGGCTGAGGACTTCAAAGAGTATCTCGAGATACTCTTTGAAGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-282s1c1
Sequence:CCGGGAAGAAGCTCAGTGCATGTATCTCGAGATACATGCACTGAGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-897s1c1
Sequence:CCGGCCTGACCATCTAGGTATTCATCTCGAGATGAATACCTAGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-630s1c1
Sequence:CCGGCCTCATGCTATCACCAAGCTACTCGAGTAGCTTGGTGATAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028514.1-303s1c1
Sequence:CCGGGATGGCTTATATCTACACTATCTCGAGATAGTGTAGATATAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138289
ACTRT1 MISSION shRNA Bacterial Glycerol Stock
actin-related protein T1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138289.3-385s21c1
Sequence:CCGGACAAGTATGAGGCCCTACATTCTCGAGAATGTAGGGCCTCATACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138289.3-333s21c1
Sequence:CCGGGTGCCTTTAGCAAGACTTAATCTCGAGATTAAGTCTTGCTAAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-823s1c1
Sequence:CCGGGCCGTGGTAAATAACATCAAACTCGAGTTTGATGTTATTTACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-1233s1c1
Sequence:CCGGCATGACCTCTATGAGCAGTTTCTCGAGAAACTGCTCATAGAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-309s1c1
Sequence:CCGGCTTGGGACATTGTAAATTCAACTCGAGTTGAATTTACAATGTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-792s1c1
Sequence:CCGGCGGGTTTAACTTCCCTTGCATCTCGAGATGCAAGGGAAGTTAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-591s1c1
Sequence:CCGGGCCTGGTTTCTACCTGTCTAACTCGAGTTAGACAGGTAGAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138289
ACTRT1 MISSION shRNA shRNA Plasmid DNA
actin-related protein T1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138289.3-385s21c1
Sequence:CCGGACAAGTATGAGGCCCTACATTCTCGAGAATGTAGGGCCTCATACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138289.3-333s21c1
Sequence:CCGGGTGCCTTTAGCAAGACTTAATCTCGAGATTAAGTCTTGCTAAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-823s1c1
Sequence:CCGGGCCGTGGTAAATAACATCAAACTCGAGTTTGATGTTATTTACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-1233s1c1
Sequence:CCGGCATGACCTCTATGAGCAGTTTCTCGAGAAACTGCTCATAGAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-309s1c1
Sequence:CCGGCTTGGGACATTGTAAATTCAACTCGAGTTGAATTTACAATGTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-792s1c1
Sequence:CCGGCGGGTTTAACTTCCCTTGCATCTCGAGATGCAAGGGAAGTTAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-591s1c1
Sequence:CCGGGCCTGGTTTCTACCTGTCTAACTCGAGTTAGACAGGTAGAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138289
ACTRT1 MISSION shRNA Lentiviral Transduction Particles
actin-related protein T1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138289.3-385s21c1
Sequence:CCGGACAAGTATGAGGCCCTACATTCTCGAGAATGTAGGGCCTCATACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138289.3-333s21c1
Sequence:CCGGGTGCCTTTAGCAAGACTTAATCTCGAGATTAAGTCTTGCTAAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-823s1c1
Sequence:CCGGGCCGTGGTAAATAACATCAAACTCGAGTTTGATGTTATTTACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-1233s1c1
Sequence:CCGGCATGACCTCTATGAGCAGTTTCTCGAGAAACTGCTCATAGAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-309s1c1
Sequence:CCGGCTTGGGACATTGTAAATTCAACTCGAGTTGAATTTACAATGTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-792s1c1
Sequence:CCGGCGGGTTTAACTTCCCTTGCATCTCGAGATGCAAGGGAAGTTAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138289.1-591s1c1
Sequence:CCGGGCCTGGTTTCTACCTGTCTAACTCGAGTTAGACAGGTAGAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks