EMAIL THIS PAGE TO A FRIEND

ACTRT2

actin-related protein T2

57 Gene Product Result for
Synonyms: ARPM2 ARPT2 Arp-T2 HARPM2
UniProtKB ID: Q8TDY3, B1AN52, Q8NHS6, Q8TDG1
Gene ID:
Human(140625) Summary: The protein encoded by this intronless gene belongs to the actin family. Studies have shown that this protein may be involved in cytoskeletal organization similar to other cytoplasmic actin-related protein (ARP) subfamily members. Antibody raised against the human protein has been used to detect the protein by immunoblotting and immunofluorescence microscopy, demonstrating its specific synthesis in the testis, late in spermatid differentiation, and its localization in the calyx. [provided by RefSeq, Jul 2008]
Mouse(73353) actin-related protein T2
Rat(298671) actin-related protein T2
chicken(428178) actin-related protein T2
cow(515214) actin-related protein T2
domestic cat(101087248) actin-related protein T2
dog(479581) actin-related protein T2
domestic guinea pig(100724608) actin-related protein T2
naked mole-rat(101722284) actin-related protein T2
sheep(101102916) actin-related protein T2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056381 MISSION® esiRNA esiRNA human ACTRT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080431 Rosetta Predictions human pricing
NM_001013937 Rosetta Predictions rat pricing
NM_028513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207384 predicted 450
2 SASI_Hs01_00207385 predicted 835
3 SASI_Hs02_00362270 predicted 566
4 SASI_Hs02_00362271 predicted 573
5 SASI_Hs02_00362272 predicted 572
6 SASI_Hs01_00207388 predicted 556
7 SASI_Hs01_00207389 predicted 1068
8 SASI_Hs01_00207390 predicted 491
9 SASI_Hs01_00207391 predicted 591
10 SASI_Hs01_00207392 predicted 867
11 SASI_Hs01_00207386 predicted 561
12 SASI_Hs01_00207387 predicted 1064
13 SASI_Hs01_00207393 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100652 predicted 302
2 SASI_Rn02_00201244 predicted 853
3 SASI_Rn01_00100653 predicted 672
4 SASI_Rn01_00100656 predicted 468
5 SASI_Rn01_00100657 predicted 832
6 SASI_Rn01_00100658 predicted 942
7 SASI_Rn02_00201245 predicted 592
8 SASI_Rn02_00201246 predicted 598
9 SASI_Rn01_00100659 predicted 1155
10 SASI_Rn01_00100660 predicted 831
11 SASI_Rn01_00100654 predicted 885
12 SASI_Rn01_00100655 predicted 888
13 SASI_Rn01_00100661 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037024 predicted 794
2 SASI_Mm02_00333985 predicted 226
3 SASI_Mm02_00333986 predicted 203
4 SASI_Mm01_00037026 predicted 885
5 SASI_Mm01_00037027 predicted 725
6 SASI_Mm01_00037028 predicted 581
7 SASI_Mm01_00037029 predicted 1025
8 SASI_Mm01_00037030 predicted 459
9 SASI_Mm01_00037031 predicted 978
10 SASI_Mm01_00037032 predicted 913
11 SASI_Mm01_00037025 predicted 326
12 SASI_Mm01_00037033 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080431
ACTRT2 MISSION shRNA Bacterial Glycerol Stock
actin-related protein T2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1037s1c1
Sequence:CCGGCACCAAGTGTGATACCGACATCTCGAGATGTCGGTATCACACTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-459s1c1
Sequence:CCGGCACCTCTTTGAGTGGGAGCTACTCGAGTAGCTCCCACTCAAAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-557s1c1
Sequence:CCGGAGAAGTCATGTTCGAGAACTTCTCGAGAAGTTCTCGAACATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1235s1c1
Sequence:CCGGTCTGAGTAGCTTCAAGCAGATCTCGAGATCTGCTTGAAGCTACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1046s1c1
Sequence:CCGGTGATACCGACATCCAGAAGATCTCGAGATCTTCTGGATGTCGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-836s21c1
Sequence:CCGGGGTCTCGTGGACGACATCAAACTCGAGTTTGATGTCGTCCACGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-357s21c1
Sequence:CCGGCCAACCAGAAGAAGTACTTTGCTCGAGCAAAGTACTTCTTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-1029s21c1
Sequence:CCGGGGCTCTCGAATATGGTCTCCACTCGAGTGGAGACCATATTCGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080431
ACTRT2 MISSION shRNA shRNA Plasmid DNA
actin-related protein T2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1037s1c1
Sequence:CCGGCACCAAGTGTGATACCGACATCTCGAGATGTCGGTATCACACTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-459s1c1
Sequence:CCGGCACCTCTTTGAGTGGGAGCTACTCGAGTAGCTCCCACTCAAAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-557s1c1
Sequence:CCGGAGAAGTCATGTTCGAGAACTTCTCGAGAAGTTCTCGAACATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1235s1c1
Sequence:CCGGTCTGAGTAGCTTCAAGCAGATCTCGAGATCTGCTTGAAGCTACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1046s1c1
Sequence:CCGGTGATACCGACATCCAGAAGATCTCGAGATCTTCTGGATGTCGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-836s21c1
Sequence:CCGGGGTCTCGTGGACGACATCAAACTCGAGTTTGATGTCGTCCACGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-357s21c1
Sequence:CCGGCCAACCAGAAGAAGTACTTTGCTCGAGCAAAGTACTTCTTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-1029s21c1
Sequence:CCGGGGCTCTCGAATATGGTCTCCACTCGAGTGGAGACCATATTCGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080431
ACTRT2 MISSION shRNA Lentiviral Transduction Particles
actin-related protein T2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1037s1c1
Sequence:CCGGCACCAAGTGTGATACCGACATCTCGAGATGTCGGTATCACACTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-459s1c1
Sequence:CCGGCACCTCTTTGAGTGGGAGCTACTCGAGTAGCTCCCACTCAAAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-557s1c1
Sequence:CCGGAGAAGTCATGTTCGAGAACTTCTCGAGAAGTTCTCGAACATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1235s1c1
Sequence:CCGGTCTGAGTAGCTTCAAGCAGATCTCGAGATCTGCTTGAAGCTACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080431.3-1046s1c1
Sequence:CCGGTGATACCGACATCCAGAAGATCTCGAGATCTTCTGGATGTCGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-836s21c1
Sequence:CCGGGGTCTCGTGGACGACATCAAACTCGAGTTTGATGTCGTCCACGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-357s21c1
Sequence:CCGGCCAACCAGAAGAAGTACTTTGCTCGAGCAAAGTACTTCTTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080431.4-1029s21c1
Sequence:CCGGGGCTCTCGAATATGGTCTCCACTCGAGTGGAGACCATATTCGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028513
ACTRT2 MISSION shRNA Bacterial Glycerol Stock
actin-related protein T2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028513.2-1258s1c1
Sequence:CCGGCATGGCCTTTAGCACCACATTCTCGAGAATGTGGTGCTAAAGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-765s1c1
Sequence:CCGGGATGTCTTGAGAGAGTACAAACTCGAGTTTGTACTCTCTCAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-888s1c1
Sequence:CCGGCAGATGGCATCTAACAGCATACTCGAGTATGCTGTTAGATGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-889s1c1
Sequence:CCGGAGATGGCATCTAACAGCATAACTCGAGTTATGCTGTTAGATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-791s1c1
Sequence:CCGGCGACGGGAATGTCATTTACATCTCGAGATGTAAATGACATTCCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028513
ACTRT2 MISSION shRNA shRNA Plasmid DNA
actin-related protein T2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028513.2-1258s1c1
Sequence:CCGGCATGGCCTTTAGCACCACATTCTCGAGAATGTGGTGCTAAAGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-765s1c1
Sequence:CCGGGATGTCTTGAGAGAGTACAAACTCGAGTTTGTACTCTCTCAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-888s1c1
Sequence:CCGGCAGATGGCATCTAACAGCATACTCGAGTATGCTGTTAGATGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-889s1c1
Sequence:CCGGAGATGGCATCTAACAGCATAACTCGAGTTATGCTGTTAGATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-791s1c1
Sequence:CCGGCGACGGGAATGTCATTTACATCTCGAGATGTAAATGACATTCCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028513
ACTRT2 MISSION shRNA Lentiviral Transduction Particles
actin-related protein T2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028513.2-1258s1c1
Sequence:CCGGCATGGCCTTTAGCACCACATTCTCGAGAATGTGGTGCTAAAGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-765s1c1
Sequence:CCGGGATGTCTTGAGAGAGTACAAACTCGAGTTTGTACTCTCTCAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-888s1c1
Sequence:CCGGCAGATGGCATCTAACAGCATACTCGAGTATGCTGTTAGATGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-889s1c1
Sequence:CCGGAGATGGCATCTAACAGCATAACTCGAGTTATGCTGTTAGATGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028513.2-791s1c1
Sequence:CCGGCGACGGGAATGTCATTTACATCTCGAGATGTAAATGACATTCCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks