EMAIL THIS PAGE TO A FRIEND

ACTRT3

actin-related protein T3

57 Gene Product Result for
Synonyms: ARP-T3 ARPM1
UniProtKB ID: Q9BYD9, Q96IS0, Q96NJ0
Gene ID:
Mouse(76652) actin related protein T3
Rat(365763) actin-related protein T3
sheep(101120792) actin-related protein T3
naked mole-rat(101720685) actin-related protein T3
domestic guinea pig(100727361) actin-related protein T3
domestic cat(101097833) actin-related protein T3
dog(488149) actin-related protein T3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032487 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032487 Rosetta Predictions human pricing
NM_001108942 Rosetta Predictions rat pricing
NM_029690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240276 predicted 1061
2 SASI_Hs01_00240277 predicted 458
3 SASI_Hs01_00240278 predicted 1047
4 SASI_Hs01_00240279 predicted 1052
5 SASI_Hs01_00240280 predicted 1292
6 SASI_Hs01_00240281 predicted 1138
7 SASI_Hs01_00240282 predicted 1059
8 SASI_Hs01_00240283 predicted 1389
9 SASI_Hs01_00240284 predicted 921
10 SASI_Hs01_00240285 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243604 predicted 614
2 SASI_Rn02_00243605 predicted 498
3 SASI_Rn02_00243606 predicted 768
4 SASI_Rn02_00243607 predicted 806
5 SASI_Rn02_00243608 predicted 534
6 SASI_Rn02_00243609 predicted 824
7 SASI_Rn02_00243610 predicted 497
8 SASI_Rn02_00243611 predicted 519
9 SASI_Rn02_00243612 predicted 318
10 SASI_Rn02_00243613 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335737 predicted 939
2 SASI_Mm01_00050405 predicted 641
3 SASI_Mm01_00050406 predicted 626
4 SASI_Mm01_00050407 predicted 851
5 SASI_Mm01_00050408 predicted 792
6 SASI_Mm01_00050409 predicted 1208
7 SASI_Mm01_00050410 predicted 596
8 SASI_Mm01_00050411 predicted 730
9 SASI_Mm01_00050412 predicted 356
10 SASI_Mm02_00335738 predicted 682
11 SASI_Mm01_00050413 predicted 970
12 SASI_Mm01_00050414 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032487
VALIDATED
ACTRT3 MISSION shRNA Bacterial Glycerol Stock
actin-related protein T3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032487.4-1755s21c1
Sequence:CCGGGAGAGCATTTGTGGTACAATACTCGAGTATTGTACCACAAATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-932s21c1
Sequence:CCGGACTACCTCATGGTGCTAATGACTCGAGTCATTAGCACCATGAGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-586s21c1
Sequence:CCGGGAGCGTGGTCTCATTACTTCACTCGAGTGAAGTAATGAGACCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032487.4-1653s21c1
Sequence:CCGGGCTCAAGAACAGATGTCTATTCTCGAGAATAGACATCTGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-1434s21c1
Sequence:CCGGGATCACTGCTGCAGAATTTAACTCGAGTTAAATTCTGCAGCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-1335s21c1
Sequence:CCGGCAACACCGCTGTGCAAGTTATCTCGAGATAACTTGCACAGCGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-559s21c1
Sequence:CCGGAGCTCGCTGTTCATCAGTTACCTCGAGGTAACTGATGAACAGCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1702s1c1
Sequence:CCGGCCCATAGTGTTTCTTCTATAACTCGAGTTATAGAAGAAACACTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032487.2-1064s1c1
Sequence:CCGGCCCGATTGTCTAGAGAAAGTTCTCGAGAACTTTCTCTAGACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1065s1c1
Sequence:CCGGCCGATTGTCTAGAGAAAGTTTCTCGAGAAACTTTCTCTAGACAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-457s1c1
Sequence:CCGGCCAGTTTATCTACCCGAACATCTCGAGATGTTCGGGTAGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1286s1c1
Sequence:CCGGCCTGGTTTAGACAAGCGGTTACTCGAGTAACCGCTTGTCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032487
VALIDATED
ACTRT3 MISSION shRNA shRNA Plasmid DNA
actin-related protein T3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032487.4-1755s21c1
Sequence:CCGGGAGAGCATTTGTGGTACAATACTCGAGTATTGTACCACAAATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-932s21c1
Sequence:CCGGACTACCTCATGGTGCTAATGACTCGAGTCATTAGCACCATGAGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-586s21c1
Sequence:CCGGGAGCGTGGTCTCATTACTTCACTCGAGTGAAGTAATGAGACCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032487.4-1653s21c1
Sequence:CCGGGCTCAAGAACAGATGTCTATTCTCGAGAATAGACATCTGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-1434s21c1
Sequence:CCGGGATCACTGCTGCAGAATTTAACTCGAGTTAAATTCTGCAGCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-1335s21c1
Sequence:CCGGCAACACCGCTGTGCAAGTTATCTCGAGATAACTTGCACAGCGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-559s21c1
Sequence:CCGGAGCTCGCTGTTCATCAGTTACCTCGAGGTAACTGATGAACAGCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1702s1c1
Sequence:CCGGCCCATAGTGTTTCTTCTATAACTCGAGTTATAGAAGAAACACTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032487.2-1064s1c1
Sequence:CCGGCCCGATTGTCTAGAGAAAGTTCTCGAGAACTTTCTCTAGACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1065s1c1
Sequence:CCGGCCGATTGTCTAGAGAAAGTTTCTCGAGAAACTTTCTCTAGACAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-457s1c1
Sequence:CCGGCCAGTTTATCTACCCGAACATCTCGAGATGTTCGGGTAGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1286s1c1
Sequence:CCGGCCTGGTTTAGACAAGCGGTTACTCGAGTAACCGCTTGTCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032487
VALIDATED
ACTRT3 MISSION shRNA Lentiviral Transduction Particles
actin-related protein T3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032487.4-1755s21c1
Sequence:CCGGGAGAGCATTTGTGGTACAATACTCGAGTATTGTACCACAAATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-932s21c1
Sequence:CCGGACTACCTCATGGTGCTAATGACTCGAGTCATTAGCACCATGAGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-586s21c1
Sequence:CCGGGAGCGTGGTCTCATTACTTCACTCGAGTGAAGTAATGAGACCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032487.4-1653s21c1
Sequence:CCGGGCTCAAGAACAGATGTCTATTCTCGAGAATAGACATCTGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-1434s21c1
Sequence:CCGGGATCACTGCTGCAGAATTTAACTCGAGTTAAATTCTGCAGCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-1335s21c1
Sequence:CCGGCAACACCGCTGTGCAAGTTATCTCGAGATAACTTGCACAGCGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032487.4-559s21c1
Sequence:CCGGAGCTCGCTGTTCATCAGTTACCTCGAGGTAACTGATGAACAGCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1702s1c1
Sequence:CCGGCCCATAGTGTTTCTTCTATAACTCGAGTTATAGAAGAAACACTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032487.2-1064s1c1
Sequence:CCGGCCCGATTGTCTAGAGAAAGTTCTCGAGAACTTTCTCTAGACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1065s1c1
Sequence:CCGGCCGATTGTCTAGAGAAAGTTTCTCGAGAAACTTTCTCTAGACAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-457s1c1
Sequence:CCGGCCAGTTTATCTACCCGAACATCTCGAGATGTTCGGGTAGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032487.2-1286s1c1
Sequence:CCGGCCTGGTTTAGACAAGCGGTTACTCGAGTAACCGCTTGTCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029690
ACTRT3 MISSION shRNA Bacterial Glycerol Stock
actin-related protein T3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029690.1-1383s1c1
Sequence:CCGGGCTGGATTTGAGAGCTTGTAACTCGAGTTACAAGCTCTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-794s1c1
Sequence:CCGGCCATATCTTGTGAATGTTGATCTCGAGATCAACATTCACAAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-103s1c1
Sequence:CCGGCCAGTTTGTCTACCCGAATATCTCGAGATATTCGGGTAGACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-730s1c1
Sequence:CCGGGCCTGATGGAAAGACTGTCAACTCGAGTTGACAGTCTTTCCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-361s1c1
Sequence:CCGGGCAACACATCTCCGAAGTGTTCTCGAGAACACTTCGGAGATGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029690
ACTRT3 MISSION shRNA shRNA Plasmid DNA
actin-related protein T3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029690.1-1383s1c1
Sequence:CCGGGCTGGATTTGAGAGCTTGTAACTCGAGTTACAAGCTCTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-794s1c1
Sequence:CCGGCCATATCTTGTGAATGTTGATCTCGAGATCAACATTCACAAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-103s1c1
Sequence:CCGGCCAGTTTGTCTACCCGAATATCTCGAGATATTCGGGTAGACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-730s1c1
Sequence:CCGGGCCTGATGGAAAGACTGTCAACTCGAGTTGACAGTCTTTCCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-361s1c1
Sequence:CCGGGCAACACATCTCCGAAGTGTTCTCGAGAACACTTCGGAGATGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029690
ACTRT3 MISSION shRNA Lentiviral Transduction Particles
actin-related protein T3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029690.1-1383s1c1
Sequence:CCGGGCTGGATTTGAGAGCTTGTAACTCGAGTTACAAGCTCTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-794s1c1
Sequence:CCGGCCATATCTTGTGAATGTTGATCTCGAGATCAACATTCACAAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-103s1c1
Sequence:CCGGCCAGTTTGTCTACCCGAATATCTCGAGATATTCGGGTAGACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-730s1c1
Sequence:CCGGGCCTGATGGAAAGACTGTCAACTCGAGTTGACAGTCTTTCCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029690.1-361s1c1
Sequence:CCGGGCAACACATCTCCGAAGTGTTCTCGAGAACACTTCGGAGATGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks