EMAIL THIS PAGE TO A FRIEND

ACVR1

activin A receptor, type I

192 Gene Product Result for
Synonyms: ACTRI ACVR1A ACVRLK2 ALK2 FOP SKR1 TSRI
UniProtKB ID: Q04771
Gene ID:
Human(90) Summary: Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
Mouse(11477) activin A receptor, type 1
Rat(79558) activin A receptor, type I
chicken(395246) activin A receptor, type I
dog(478757) activin A receptor, type I
cow(338068) activin A receptor, type I
Horse(100050899) activin A receptor, type I
domestic cat(101091298) activin A receptor, type I
naked mole-rat(101711343) activin A receptor, type I
domestic guinea pig(100724428) activin A receptor, type I
sheep(443161) activin A receptor, type I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306388 ANTI-ACTIVIN RECEPTOR TYPE IA (ACVR1) (CENTER R147) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB2108587 Anti-ACVR1 affinity isolated antibody guinea pig, rat, horse, human, bovine, bovine, pig, goat, canine, rabbit
immunohistochemistry, western blot pricing
SAB2500024 Anti-ACVR1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human, canine
ELISA, immunohistochemistry, western blot pricing
HPA007505 Anti-ACVR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV45040 Anti-ACVR1 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, guinea pig, bovine, mouse, canine, rat
immunohistochemistry, western blot pricing
SAB2100043 Anti-ACVR1 antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, mouse, rat, bovine, rabbit, canine
western blot pricing
SAB3500435 Anti-ACVR1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1302619 ANTI-MOUSE ACVR1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1402682 Monoclonal Anti-ACVR1 antibody produced in mouse clone 2D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105 siRNAs that have been validated in the lab human pricing
NM_001111067 Rosetta Predictions human pricing
NM_024486 Rosetta Predictions rat pricing
NM_001110204 Rosetta Predictions mouse pricing
NM_001110205 Rosetta Predictions mouse pricing
NM_007394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228878 validated 1634
1 SASI_Hs01_00228875 validated 1807
1 SASI_Hs01_00228876 validated 1291
2 SASI_Hs01_00228877 predicted 1315
3 SASI_Hs01_00228879 predicted 1147
4 SASI_Hs01_00228880 predicted 1472
5 SASI_Hs01_00228881 predicted 945
6 SASI_Hs01_00228882 predicted 773
7 SASI_Hs01_00228883 predicted 1328
8 SASI_Hs01_00228884 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325216 predicted 1626
2 SASI_Hs02_00325217 predicted 1108
3 SASI_Hs02_00325218 predicted 1129
4 SASI_Hs02_00325219 predicted 1445
5 SASI_Hs02_00325220 predicted 965
6 SASI_Hs02_00325221 predicted 1287
7 SASI_Hs02_00325222 predicted 767
8 SASI_Hs02_00325223 predicted 594
9 SASI_Hs02_00325224 predicted 1153
10 SASI_Hs02_00325225 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081043 predicted 1007
2 SASI_Rn01_00081044 predicted 906
3 SASI_Rn01_00081045 predicted 1311
4 SASI_Rn01_00081046 predicted 465
5 SASI_Rn01_00081047 predicted 921
6 SASI_Rn02_00264016 predicted 1432
7 SASI_Rn01_00081048 predicted 512
8 SASI_Rn02_00264017 predicted 1204
9 SASI_Rn01_00081050 predicted 694
10 SASI_Rn01_00081051 predicted 980
11 SASI_Rn01_00081042 predicted 1399
12 SASI_Rn01_00081049 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304916 predicted 2207
2 SASI_Mm02_00304917 predicted 1529
3 SASI_Mm02_00304918 predicted 2215
4 SASI_Mm02_00304919 predicted 1832
5 SASI_Mm02_00304920 predicted 1915
6 SASI_Mm02_00304921 predicted 1421
7 SASI_Mm02_00304922 predicted 1180
8 SASI_Mm02_00304923 predicted 1283
9 SASI_Mm02_00304924 predicted 1913
10 SASI_Mm02_00304925 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304926 predicted 1685
2 SASI_Mm02_00304927 predicted 1007
3 SASI_Mm02_00304928 predicted 1693
4 SASI_Mm02_00304929 predicted 1312
5 SASI_Mm02_00304930 predicted 1399
6 SASI_Mm02_00304931 predicted 905
7 SASI_Mm02_00304932 predicted 656
8 SASI_Mm02_00304933 predicted 755
9 SASI_Mm02_00304934 predicted 1388
10 SASI_Mm02_00304935 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082065 predicted 1956
2 SASI_Mm02_00311505 predicted 1287
3 SASI_Mm01_00082067 predicted 1969
4 SASI_Mm01_00082068 predicted 1582
5 SASI_Mm02_00311506 predicted 1670
6 SASI_Mm01_00082069 predicted 1180
7 SASI_Mm01_00082070 predicted 938
8 SASI_Mm01_00082072 predicted 1039
9 SASI_Mm01_00082073 predicted 1664
10 SASI_Mm01_00082074 predicted 1166
11 SASI_Mm01_00082066 predicted 227
12 SASI_Mm01_00082071 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105
VALIDATED
ACVR1 MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type I
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-1589s1c1
Sequence:CCGGCGGATGGTGAGCAATGGTATACTCGAGTATACCATTGCTCACCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-869s1c1
Sequence:CCGGGACAGCACTTTAGCAGATTTACTCGAGTAAATCTGCTAAAGTGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-1517s1c1
Sequence:CCGGGTGGATTGTTTCGATTCTTATCTCGAGATAAGAATCGAAACAATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001105.x-2723s1c1
Sequence:CCGGGCAGAACGTATTTAGCCATTACTCGAGTAATGGCTAAATACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001105.x-1757s1c1
Sequence:CCGGCTAATGAAAGAATGCTGGTATCTCGAGATACCAGCATTCTTTCATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001105.2-703s1c1
Sequence:CCGGCTTGGAGGTTGGCCTCATTATCTCGAGATAATGAGGCCAACCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001105.2-2378s1c1
Sequence:CCGGCTGGTCTGTCTTTGGATAATACTCGAGTATTATCCAAAGACAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001105.2-2317s1c1
Sequence:CCGGCTTGCACTGTTACTCTTAATTCTCGAGAATTAAGAGTAACAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105.4-1924s21c1
Sequence:GTACCGGTGATAATTCCCTCGACAAATTCTCGAGAATTTGTCGAGGGAATTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-1607s21c1
Sequence:CCGGGTGGATTGTTTCGATTCTTATCTCGAGATAAGAATCGAAACAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-2027s21c1
Sequence:CCGGGCCTGACTGGTTGTCAGAATGCTCGAGCATTCTGACAACCAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-1679s21c1
Sequence:CCGGCGGATGGTGAGCAATGGTATACTCGAGTATACCATTGCTCACCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105.4-959s21c1
Sequence:CCGGGACAGCACTTTAGCAGATTTACTCGAGTAAATCTGCTAAAGTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105
VALIDATED
ACVR1 MISSION shRNA shRNA Plasmid DNA
activin A receptor, type I
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-1589s1c1
Sequence:CCGGCGGATGGTGAGCAATGGTATACTCGAGTATACCATTGCTCACCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-869s1c1
Sequence:CCGGGACAGCACTTTAGCAGATTTACTCGAGTAAATCTGCTAAAGTGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-1517s1c1
Sequence:CCGGGTGGATTGTTTCGATTCTTATCTCGAGATAAGAATCGAAACAATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001105.x-2723s1c1
Sequence:CCGGGCAGAACGTATTTAGCCATTACTCGAGTAATGGCTAAATACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001105.x-1757s1c1
Sequence:CCGGCTAATGAAAGAATGCTGGTATCTCGAGATACCAGCATTCTTTCATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001105.2-703s1c1
Sequence:CCGGCTTGGAGGTTGGCCTCATTATCTCGAGATAATGAGGCCAACCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001105.2-2378s1c1
Sequence:CCGGCTGGTCTGTCTTTGGATAATACTCGAGTATTATCCAAAGACAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001105.2-2317s1c1
Sequence:CCGGCTTGCACTGTTACTCTTAATTCTCGAGAATTAAGAGTAACAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105.4-1924s21c1
Sequence:GTACCGGTGATAATTCCCTCGACAAATTCTCGAGAATTTGTCGAGGGAATTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-1607s21c1
Sequence:CCGGGTGGATTGTTTCGATTCTTATCTCGAGATAAGAATCGAAACAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-2027s21c1
Sequence:CCGGGCCTGACTGGTTGTCAGAATGCTCGAGCATTCTGACAACCAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-1679s21c1
Sequence:CCGGCGGATGGTGAGCAATGGTATACTCGAGTATACCATTGCTCACCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105.4-959s21c1
Sequence:CCGGGACAGCACTTTAGCAGATTTACTCGAGTAAATCTGCTAAAGTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105
VALIDATED
ACVR1 MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type I
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-1589s1c1
Sequence:CCGGCGGATGGTGAGCAATGGTATACTCGAGTATACCATTGCTCACCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-869s1c1
Sequence:CCGGGACAGCACTTTAGCAGATTTACTCGAGTAAATCTGCTAAAGTGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001105.x-1517s1c1
Sequence:CCGGGTGGATTGTTTCGATTCTTATCTCGAGATAAGAATCGAAACAATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001105.x-2723s1c1
Sequence:CCGGGCAGAACGTATTTAGCCATTACTCGAGTAATGGCTAAATACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001105.x-1757s1c1
Sequence:CCGGCTAATGAAAGAATGCTGGTATCTCGAGATACCAGCATTCTTTCATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001105.2-703s1c1
Sequence:CCGGCTTGGAGGTTGGCCTCATTATCTCGAGATAATGAGGCCAACCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001105.2-2378s1c1
Sequence:CCGGCTGGTCTGTCTTTGGATAATACTCGAGTATTATCCAAAGACAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001105.2-2317s1c1
Sequence:CCGGCTTGCACTGTTACTCTTAATTCTCGAGAATTAAGAGTAACAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105.4-1924s21c1
Sequence:GTACCGGTGATAATTCCCTCGACAAATTCTCGAGAATTTGTCGAGGGAATTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-1607s21c1
Sequence:CCGGGTGGATTGTTTCGATTCTTATCTCGAGATAAGAATCGAAACAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-2027s21c1
Sequence:CCGGGCCTGACTGGTTGTCAGAATGCTCGAGCATTCTGACAACCAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001105.4-1679s21c1
Sequence:CCGGCGGATGGTGAGCAATGGTATACTCGAGTATACCATTGCTCACCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105.4-959s21c1
Sequence:CCGGGACAGCACTTTAGCAGATTTACTCGAGTAAATCTGCTAAAGTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007394
VALIDATED
ACVR1 MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type I
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007394.2-986s1c1
Sequence:CCGGCATCACACATTACCATGAAATCTCGAGATTTCATGGTAATGTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1402s1c1
Sequence:CCGGGCAATGGTATAGTGGAAGATTCTCGAGAATCTTCCACTATACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-582s1c1
Sequence:CCGGAGGAAGTTTAAGAGACGCAATCTCGAGATTGCGTCTCTTAAACTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1538s1c1
Sequence:CCGGGACATTAACTTCTCTGGCGAACTCGAGTTCGCCAGAGAAGTTAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1230s1c1
Sequence:CCGGCAGAGCACAAACCAGCTTGATCTCGAGATCAAGCTGGTTTGTGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1155s21c1
Sequence:CCGGTGGTTCAGGGAGACGGAATTGCTCGAGCAATTCCGTCTCCCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007394.3-2403s21c1
Sequence:CCGGACTTGCACTGTGGCCCTTAATCTCGAGATTAAGGGCCACAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-851s21c1
Sequence:CCGGAGTTGCTCTCAGGAAGTTTAACTCGAGTTAAACTTCCTGAGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007394.3-1992s21c1
Sequence:CCGGTTGTCCAGCTGGGACCTAATGCTCGAGCATTAGGTCCCAGCTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1615s21c1
Sequence:CCGGCTTATAAGAGGGTCGATATTTCTCGAGAAATATCGACCCTCTTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1803s21c1
Sequence:CCGGTGGTTCTCAGACCCGACATTACTCGAGTAATGTCGGGTCTGAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1915s21c1
Sequence:CCGGTCGATAATTCCCTAGACAAATCTCGAGATTTGTCTAGGGAATTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007394
VALIDATED
ACVR1 MISSION shRNA shRNA Plasmid DNA
activin A receptor, type I
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007394.2-986s1c1
Sequence:CCGGCATCACACATTACCATGAAATCTCGAGATTTCATGGTAATGTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1402s1c1
Sequence:CCGGGCAATGGTATAGTGGAAGATTCTCGAGAATCTTCCACTATACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-582s1c1
Sequence:CCGGAGGAAGTTTAAGAGACGCAATCTCGAGATTGCGTCTCTTAAACTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1538s1c1
Sequence:CCGGGACATTAACTTCTCTGGCGAACTCGAGTTCGCCAGAGAAGTTAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1230s1c1
Sequence:CCGGCAGAGCACAAACCAGCTTGATCTCGAGATCAAGCTGGTTTGTGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1155s21c1
Sequence:CCGGTGGTTCAGGGAGACGGAATTGCTCGAGCAATTCCGTCTCCCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007394.3-2403s21c1
Sequence:CCGGACTTGCACTGTGGCCCTTAATCTCGAGATTAAGGGCCACAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-851s21c1
Sequence:CCGGAGTTGCTCTCAGGAAGTTTAACTCGAGTTAAACTTCCTGAGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007394.3-1992s21c1
Sequence:CCGGTTGTCCAGCTGGGACCTAATGCTCGAGCATTAGGTCCCAGCTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1615s21c1
Sequence:CCGGCTTATAAGAGGGTCGATATTTCTCGAGAAATATCGACCCTCTTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1803s21c1
Sequence:CCGGTGGTTCTCAGACCCGACATTACTCGAGTAATGTCGGGTCTGAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1915s21c1
Sequence:CCGGTCGATAATTCCCTAGACAAATCTCGAGATTTGTCTAGGGAATTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007394
VALIDATED
ACVR1 MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type I
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007394.2-986s1c1
Sequence:CCGGCATCACACATTACCATGAAATCTCGAGATTTCATGGTAATGTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1402s1c1
Sequence:CCGGGCAATGGTATAGTGGAAGATTCTCGAGAATCTTCCACTATACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-582s1c1
Sequence:CCGGAGGAAGTTTAAGAGACGCAATCTCGAGATTGCGTCTCTTAAACTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1538s1c1
Sequence:CCGGGACATTAACTTCTCTGGCGAACTCGAGTTCGCCAGAGAAGTTAATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007394.2-1230s1c1
Sequence:CCGGCAGAGCACAAACCAGCTTGATCTCGAGATCAAGCTGGTTTGTGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1155s21c1
Sequence:CCGGTGGTTCAGGGAGACGGAATTGCTCGAGCAATTCCGTCTCCCTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007394.3-2403s21c1
Sequence:CCGGACTTGCACTGTGGCCCTTAATCTCGAGATTAAGGGCCACAGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-851s21c1
Sequence:CCGGAGTTGCTCTCAGGAAGTTTAACTCGAGTTAAACTTCCTGAGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007394.3-1992s21c1
Sequence:CCGGTTGTCCAGCTGGGACCTAATGCTCGAGCATTAGGTCCCAGCTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1615s21c1
Sequence:CCGGCTTATAAGAGGGTCGATATTTCTCGAGAAATATCGACCCTCTTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1803s21c1
Sequence:CCGGTGGTTCTCAGACCCGACATTACTCGAGTAATGTCGGGTCTGAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007394.3-1915s21c1
Sequence:CCGGTCGATAATTCCCTAGACAAATCTCGAGATTTGTCTAGGGAATTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks