EMAIL THIS PAGE TO A FRIEND

ACVR1B

activin A receptor, type IB

229 Gene Product Result for
Synonyms: ACTRIB ACVRLK4 ALK4 SKR2
Gene ID:
Human(91) Summary: This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
Mouse(11479) activin A receptor, type 1B
Rat(29381) activin A receptor, type IB
sheep(101113836) activin A receptor, type IB
sheep(443254) activin A receptor, type IB
domestic guinea pig(100733441) activin A receptor, type IB
naked mole-rat(101709452) activin A receptor, type IB
Zebrafish(30183) activin A receptor, type IB
chicken(768878) activin A receptor, type IB
domestic cat(101097654) activin A receptor, type IB
cow(539315) activin A receptor, type IB
Horse(100062619) activin A receptor, type IB
dog(486537) activin A receptor, type IB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_004302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004302 siRNAs that have been validated in the lab human pricing
NM_020327 Rosetta Predictions human pricing
NM_020328 Rosetta Predictions human pricing
NM_199230 Rosetta Predictions rat pricing
NM_007395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004302 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125466 validated 881
1 SASI_Hs01_00125464 validated 448
2 SASI_Hs01_00125465 predicted 826
3 SASI_Hs01_00125467 predicted 829
4 SASI_Hs01_00125469 predicted 488
5 SASI_Hs01_00125470 predicted 1023
6 SASI_Hs01_00125471 predicted 501
7 SASI_Hs01_00125472 predicted 319
8 SASI_Hs02_00337322 predicted 280
9 SASI_Hs02_00337323 predicted 1026
10 SASI_Hs02_00337324 predicted 772
11 SASI_Hs02_00337325 predicted 533
12 SASI_Hs01_00125468 predicted 1016
13 SASI_Hs01_00125473 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028552 predicted 822
2 SASI_Hs01_00028554 predicted 827
3 SASI_Hs01_00028556 predicted 482
4 SASI_Hs01_00028557 predicted 1028
5 SASI_Hs01_00028558 predicted 499
6 SASI_Hs01_00028559 predicted 323
7 SASI_Hs02_00353251 predicted 276
8 SASI_Hs02_00353252 predicted 1024
9 SASI_Hs02_00353253 predicted 769
10 SASI_Hs02_00353254 predicted 533
11 SASI_Hs01_00028551 predicted 443
12 SASI_Hs01_00028553 predicted 877
13 SASI_Hs01_00028555 predicted 1013
14 SASI_Hs01_00028560 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105436 predicted 824
2 SASI_Hs01_00105438 predicted 825
3 SASI_Hs01_00105440 predicted 490
4 SASI_Hs01_00105441 predicted 1022
5 SASI_Hs01_00105442 predicted 500
6 SASI_Hs01_00105443 predicted 326
7 SASI_Hs02_00353255 predicted 276
8 SASI_Hs02_00353256 predicted 1020
9 SASI_Hs02_00353257 predicted 765
10 SASI_Hs02_00353258 predicted 537
11 SASI_Hs01_00105435 predicted 447
12 SASI_Hs01_00105437 predicted 881
13 SASI_Hs01_00105439 predicted 1016
14 SASI_Hs01_00105444 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070550 predicted 1242
2 SASI_Rn02_00270152 predicted 1109
3 SASI_Rn01_00070551 predicted 294
4 SASI_Rn01_00070552 predicted 1278
5 SASI_Rn02_00270153 predicted 1021
6 SASI_Rn01_00070553 predicted 766
7 SASI_Rn01_00070555 predicted 1178
8 SASI_Rn01_00070556 predicted 464
9 SASI_Rn01_00070557 predicted 1549
10 SASI_Rn01_00070558 predicted 1389
11 SASI_Rn01_00070554 predicted 259
12 SASI_Rn01_00070559 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085104 predicted 519
2 SASI_Mm01_00085105 predicted 1464
3 SASI_Mm01_00085106 predicted 1411
4 SASI_Mm01_00085107 predicted 289
5 SASI_Mm01_00085108 predicted 1330
6 SASI_Mm01_00085109 predicted 288
7 SASI_Mm01_00085110 predicted 1401
8 SASI_Mm01_00085111 predicted 521
9 SASI_Mm01_00085112 predicted 1510
10 SASI_Mm01_00085113 predicted 1760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020328
ACVR1B MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IB
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-1413s21c1
Sequence:CCGGAGAGCCTGAATCATCGTTTAACTCGAGTTAAACGATGATTCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-902s21c1
Sequence:CCGGACGGGTCCCTGTTTGATTATCCTCGAGGATAATCAAACAGGGACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-775s21c1
Sequence:CCGGTTCAGGGAAGCAGAGATATACCTCGAGGTATATCTCTGCTTCCCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-1462s21c1
Sequence:CCGGGTGCTTAGGGTGCGTTTATTCCTCGAGGAATAAACGCACCCTAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-1260s1c1
Sequence:CCGGCGGGCTTGTATATTGGGAGATCTCGAGATCTCCCAATATACAAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-783s1c1
Sequence:CCGGAGCAGAGATATACCAGACGGTCTCGAGACCGTCTGGTATATCTCTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-873s1c1
Sequence:CCGGGCTGTGGCTTGTTTCTGACTACTCGAGTAGTCAGAAACAAGCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-321s1c1
Sequence:CCGGCCACTGCTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAGCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020328
ACVR1B MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IB
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-1413s21c1
Sequence:CCGGAGAGCCTGAATCATCGTTTAACTCGAGTTAAACGATGATTCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-902s21c1
Sequence:CCGGACGGGTCCCTGTTTGATTATCCTCGAGGATAATCAAACAGGGACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-775s21c1
Sequence:CCGGTTCAGGGAAGCAGAGATATACCTCGAGGTATATCTCTGCTTCCCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-1462s21c1
Sequence:CCGGGTGCTTAGGGTGCGTTTATTCCTCGAGGAATAAACGCACCCTAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-1260s1c1
Sequence:CCGGCGGGCTTGTATATTGGGAGATCTCGAGATCTCCCAATATACAAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-783s1c1
Sequence:CCGGAGCAGAGATATACCAGACGGTCTCGAGACCGTCTGGTATATCTCTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-873s1c1
Sequence:CCGGGCTGTGGCTTGTTTCTGACTACTCGAGTAGTCAGAAACAAGCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-321s1c1
Sequence:CCGGCCACTGCTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAGCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020328
ACVR1B MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IB
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-1413s21c1
Sequence:CCGGAGAGCCTGAATCATCGTTTAACTCGAGTTAAACGATGATTCAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-902s21c1
Sequence:CCGGACGGGTCCCTGTTTGATTATCCTCGAGGATAATCAAACAGGGACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-775s21c1
Sequence:CCGGTTCAGGGAAGCAGAGATATACCTCGAGGTATATCTCTGCTTCCCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020328.2-1462s21c1
Sequence:CCGGGTGCTTAGGGTGCGTTTATTCCTCGAGGAATAAACGCACCCTAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-1260s1c1
Sequence:CCGGCGGGCTTGTATATTGGGAGATCTCGAGATCTCCCAATATACAAGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-783s1c1
Sequence:CCGGAGCAGAGATATACCAGACGGTCTCGAGACCGTCTGGTATATCTCTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-873s1c1
Sequence:CCGGGCTGTGGCTTGTTTCTGACTACTCGAGTAGTCAGAAACAAGCCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020328.x-321s1c1
Sequence:CCGGCCACTGCTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAGCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004302
ACVR1B MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IB
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1277s21c1
Sequence:GTACCGGAGATTGCTCGAAGATGCAATTCTCGAGAATTGCATCTTCGAGCAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004302.3-3866s21c1
Sequence:CCGGCCTAACCTTTGGGCCAATTTACTCGAGTAAATTGGCCCAAAGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1251s21c1
Sequence:CCGGTTATGCCCTCGGGCTTGTATACTCGAGTATACAAGCCCGAGGGCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1195s21c1
Sequence:CCGGGTACTTGATGAAACCATTAATCTCGAGATTAATGGTTTCATCAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-491s21c1
Sequence:CCGGACTATCATCAGCGTGTCTATCCTCGAGGATAGACACGCTGATGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-3972s1c1
Sequence:CCGGGCAGAACCTTGGCGGTTTATACTCGAGTATAAACCGCCAAGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-1031s1c1
Sequence:CCGGGAATTGCTCATCGAGACTTAACTCGAGTTAAGTCTCGATGAGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-339s1c1
Sequence:CCGGCTACTGCAACAGGATCGACTTCTCGAGAAGTCGATCCTGTTGCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.3-1323s1c1
Sequence:CCGGGCTGCCATATTACGACTTAGTCTCGAGACTAAGTCGTAATATGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-2948s1c1
Sequence:CCGGGTCAGCATATCTTAGGTATATCTCGAGATATACCTAAGATATGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-4310s1c1
Sequence:CCGGCCGTTCTTACGTCGCCATAAACTCGAGTTTATGGCGACGTAAGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-1230s1c1
Sequence:CCGGCTCCTTTAAATGTGCTGATATCTCGAGATATCAGCACATTTAAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-927s1c1
Sequence:CCGGCCGGTACACAGTGACAATTGACTCGAGTCAATTGTCACTGTGTACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-318s1c1
Sequence:CCGGCCACTGCTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAGCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-872s1c1
Sequence:CCGGTGTGGCTTGTTTCTGACTATCCTCGAGGATAGTCAGAAACAAGCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-1258s1c1
Sequence:CCGGGGGCTTGTATATTGGGAGATTCTCGAGAATCTCCCAATATACAAGCCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-776s1c1
Sequence:CCGGGGGAAGCAGAGATATACCAGACTCGAGTCTGGTATATCTCTGCTTCCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004302
ACVR1B MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IB
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1277s21c1
Sequence:GTACCGGAGATTGCTCGAAGATGCAATTCTCGAGAATTGCATCTTCGAGCAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004302.3-3866s21c1
Sequence:CCGGCCTAACCTTTGGGCCAATTTACTCGAGTAAATTGGCCCAAAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1251s21c1
Sequence:CCGGTTATGCCCTCGGGCTTGTATACTCGAGTATACAAGCCCGAGGGCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1195s21c1
Sequence:CCGGGTACTTGATGAAACCATTAATCTCGAGATTAATGGTTTCATCAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-491s21c1
Sequence:CCGGACTATCATCAGCGTGTCTATCCTCGAGGATAGACACGCTGATGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-3972s1c1
Sequence:CCGGGCAGAACCTTGGCGGTTTATACTCGAGTATAAACCGCCAAGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-1031s1c1
Sequence:CCGGGAATTGCTCATCGAGACTTAACTCGAGTTAAGTCTCGATGAGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-339s1c1
Sequence:CCGGCTACTGCAACAGGATCGACTTCTCGAGAAGTCGATCCTGTTGCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.3-1323s1c1
Sequence:CCGGGCTGCCATATTACGACTTAGTCTCGAGACTAAGTCGTAATATGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-2948s1c1
Sequence:CCGGGTCAGCATATCTTAGGTATATCTCGAGATATACCTAAGATATGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-4310s1c1
Sequence:CCGGCCGTTCTTACGTCGCCATAAACTCGAGTTTATGGCGACGTAAGAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-1230s1c1
Sequence:CCGGCTCCTTTAAATGTGCTGATATCTCGAGATATCAGCACATTTAAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-927s1c1
Sequence:CCGGCCGGTACACAGTGACAATTGACTCGAGTCAATTGTCACTGTGTACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-318s1c1
Sequence:CCGGCCACTGCTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAGCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-872s1c1
Sequence:CCGGTGTGGCTTGTTTCTGACTATCCTCGAGGATAGTCAGAAACAAGCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-1258s1c1
Sequence:CCGGGGGCTTGTATATTGGGAGATTCTCGAGAATCTCCCAATATACAAGCCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-776s1c1
Sequence:CCGGGGGAAGCAGAGATATACCAGACTCGAGTCTGGTATATCTCTGCTTCCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004302
ACVR1B MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IB
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1277s21c1
Sequence:GTACCGGAGATTGCTCGAAGATGCAATTCTCGAGAATTGCATCTTCGAGCAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004302.3-3866s21c1
Sequence:CCGGCCTAACCTTTGGGCCAATTTACTCGAGTAAATTGGCCCAAAGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1251s21c1
Sequence:CCGGTTATGCCCTCGGGCTTGTATACTCGAGTATACAAGCCCGAGGGCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-1195s21c1
Sequence:CCGGGTACTTGATGAAACCATTAATCTCGAGATTAATGGTTTCATCAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004302.3-491s21c1
Sequence:CCGGACTATCATCAGCGTGTCTATCCTCGAGGATAGACACGCTGATGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-3972s1c1
Sequence:CCGGGCAGAACCTTGGCGGTTTATACTCGAGTATAAACCGCCAAGGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-1031s1c1
Sequence:CCGGGAATTGCTCATCGAGACTTAACTCGAGTTAAGTCTCGATGAGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-339s1c1
Sequence:CCGGCTACTGCAACAGGATCGACTTCTCGAGAAGTCGATCCTGTTGCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.3-1323s1c1
Sequence:CCGGGCTGCCATATTACGACTTAGTCTCGAGACTAAGTCGTAATATGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-2948s1c1
Sequence:CCGGGTCAGCATATCTTAGGTATATCTCGAGATATACCTAAGATATGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004302.3-4310s1c1
Sequence:CCGGCCGTTCTTACGTCGCCATAAACTCGAGTTTATGGCGACGTAAGAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-1230s1c1
Sequence:CCGGCTCCTTTAAATGTGCTGATATCTCGAGATATCAGCACATTTAAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004302.3-927s1c1
Sequence:CCGGCCGGTACACAGTGACAATTGACTCGAGTCAATTGTCACTGTGTACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-318s1c1
Sequence:CCGGCCACTGCTGCTACACTGACTACTCGAGTAGTCAGTGTAGCAGCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-872s1c1
Sequence:CCGGTGTGGCTTGTTTCTGACTATCCTCGAGGATAGTCAGAAACAAGCCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-1258s1c1
Sequence:CCGGGGGCTTGTATATTGGGAGATTCTCGAGAATCTCCCAATATACAAGCCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004302.x-776s1c1
Sequence:CCGGGGGAAGCAGAGATATACCAGACTCGAGTCTGGTATATCTCTGCTTCCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007395
ACVR1B MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IB
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-1517s21c1
Sequence:CCGGGCAGGAAGATGTGAAGATTTACTCGAGTAAATCTTCACATCTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-808s21c1
Sequence:CCGGGCTTTATTGCTGCTGACAATACTCGAGTATTGTCAGCAGCAATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-304s21c1
Sequence:CCGGGCTGCTATATTGACTTCTGCACTCGAGTGCAGAAGTCAATATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-915s21c1
Sequence:CCGGGTGACCATTGAGGGAATGATTCTCGAGAATCATTCCCTCAATGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-1506s1c1
Sequence:CCGGGCAGGAAGATGTGAAGATTTACTCGAGTAAATCTTCACATCTTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-293s1c1
Sequence:CCGGGCTGCTATATTGACTTCTGCACTCGAGTGCAGAAGTCAATATAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-797s1c1
Sequence:CCGGGCTTTATTGCTGCTGACAATACTCGAGTATTGTCAGCAGCAATAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-1279s1c1
Sequence:CCGGGAAGACTATCAACTGCCGTATCTCGAGATACGGCAGTTGATAGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-904s1c1
Sequence:CCGGGTGACCATTGAGGGAATGATTCTCGAGAATCATTCCCTCAATGGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007395
ACVR1B MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IB
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-1517s21c1
Sequence:CCGGGCAGGAAGATGTGAAGATTTACTCGAGTAAATCTTCACATCTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-808s21c1
Sequence:CCGGGCTTTATTGCTGCTGACAATACTCGAGTATTGTCAGCAGCAATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-304s21c1
Sequence:CCGGGCTGCTATATTGACTTCTGCACTCGAGTGCAGAAGTCAATATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-915s21c1
Sequence:CCGGGTGACCATTGAGGGAATGATTCTCGAGAATCATTCCCTCAATGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-1506s1c1
Sequence:CCGGGCAGGAAGATGTGAAGATTTACTCGAGTAAATCTTCACATCTTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-293s1c1
Sequence:CCGGGCTGCTATATTGACTTCTGCACTCGAGTGCAGAAGTCAATATAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-797s1c1
Sequence:CCGGGCTTTATTGCTGCTGACAATACTCGAGTATTGTCAGCAGCAATAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-1279s1c1
Sequence:CCGGGAAGACTATCAACTGCCGTATCTCGAGATACGGCAGTTGATAGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-904s1c1
Sequence:CCGGGTGACCATTGAGGGAATGATTCTCGAGAATCATTCCCTCAATGGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007395
ACVR1B MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IB
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-1517s21c1
Sequence:CCGGGCAGGAAGATGTGAAGATTTACTCGAGTAAATCTTCACATCTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-808s21c1
Sequence:CCGGGCTTTATTGCTGCTGACAATACTCGAGTATTGTCAGCAGCAATAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-304s21c1
Sequence:CCGGGCTGCTATATTGACTTCTGCACTCGAGTGCAGAAGTCAATATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007395.3-915s21c1
Sequence:CCGGGTGACCATTGAGGGAATGATTCTCGAGAATCATTCCCTCAATGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-1506s1c1
Sequence:CCGGGCAGGAAGATGTGAAGATTTACTCGAGTAAATCTTCACATCTTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-293s1c1
Sequence:CCGGGCTGCTATATTGACTTCTGCACTCGAGTGCAGAAGTCAATATAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-797s1c1
Sequence:CCGGGCTTTATTGCTGCTGACAATACTCGAGTATTGTCAGCAGCAATAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-1279s1c1
Sequence:CCGGGAAGACTATCAACTGCCGTATCTCGAGATACGGCAGTTGATAGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007395.1-904s1c1
Sequence:CCGGGTGACCATTGAGGGAATGATTCTCGAGAATCATTCCCTCAATGGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)