EMAIL THIS PAGE TO A FRIEND

ACVR1C

activin A receptor, type IC

148 Gene Product Result for
Synonyms: ACVRLK7 ALK7
UniProtKB ID: Q8NER5, Q4ZFZ8, Q86UL1, Q86UL2, Q8TBG2
Gene ID:
Human(130399) Summary: ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]
Mouse(269275) activin A receptor, type IC
Rat(245921) activin A receptor, type IC
chicken(424325) activin A receptor, type IC
dog(488361) activin A receptor, type IC
cow(536380) activin A receptor, type IC
Horse(100059573) activin A receptor, type IC
domestic cat(101091037) activin A receptor, type IC
naked mole-rat(101712645) activin A receptor, type IC
domestic guinea pig(100724706) activin A receptor, type IC
sheep(101111867) activin A receptor, type IC
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1885 Rat ALK-7 ELISA for serum, plasma and cell culture supernatants rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001111030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111031 Rosetta Predictions human pricing
NM_001111032 Rosetta Predictions human pricing
NM_001111033 Rosetta Predictions human pricing
NM_145259 Rosetta Predictions human pricing
NM_139090 Rosetta Predictions rat pricing
NM_001033369 Rosetta Predictions mouse pricing
NM_001111030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325096 predicted 1351
2 SASI_Hs02_00325097 predicted 1192
3 SASI_Hs02_00325098 predicted 1192
4 SASI_Hs02_00325099 predicted 1227
5 SASI_Hs02_00325100 predicted 1404
6 SASI_Hs02_00325101 predicted 1450
7 SASI_Hs02_00325102 predicted 2023
8 SASI_Hs02_00325103 predicted 2021
9 SASI_Hs02_00325104 predicted 1322
10 SASI_Hs02_00325105 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325106 predicted 1224
2 SASI_Hs02_00325107 predicted 1061
3 SASI_Hs02_00325108 predicted 1012
4 SASI_Hs02_00325109 predicted 1064
5 SASI_Hs02_00325110 predicted 1100
6 SASI_Hs02_00325111 predicted 1278
7 SASI_Hs02_00325112 predicted 1232
8 SASI_Hs02_00325113 predicted 1895
9 SASI_Hs02_00325114 predicted 1893
10 SASI_Hs02_00325115 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325116 predicted 989
2 SASI_Hs02_00325117 predicted 838
3 SASI_Hs02_00325118 predicted 827
4 SASI_Hs02_00325119 predicted 867
5 SASI_Hs02_00325120 predicted 1049
6 SASI_Hs02_00325121 predicted 1087
7 SASI_Hs02_00325122 predicted 1664
8 SASI_Hs02_00325123 predicted 1664
9 SASI_Hs02_00325124 predicted 968
10 SASI_Hs02_00325125 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242873 predicted 1459
2 SASI_Hs01_00242874 predicted 1303
3 SASI_Hs02_00365116 predicted 1303
4 SASI_Hs02_00365117 predicted 1335
5 SASI_Hs01_00242876 predicted 1514
6 SASI_Hs01_00242878 predicted 1558
7 SASI_Hs02_00365118 predicted 2136
8 SASI_Hs02_00365119 predicted 2138
9 SASI_Hs02_00365120 predicted 1433
10 SASI_Hs02_00365121 predicted 1255
11 SASI_Hs01_00242870 predicted 1198
12 SASI_Hs01_00242871 predicted 818
13 SASI_Hs01_00242872 predicted 1375
14 SASI_Hs01_00242875 predicted 388
15 SASI_Hs01_00242877 predicted 460
16 SASI_Hs01_00242879 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106853 predicted 1183
2 SASI_Rn01_00106854 predicted 1105
3 SASI_Rn01_00106855 predicted 1089
4 SASI_Rn01_00106856 predicted 718
5 SASI_Rn02_00268457 predicted 1661
6 SASI_Rn01_00106857 predicted 311
7 SASI_Rn01_00106858 predicted 1240
8 SASI_Rn01_00106860 predicted 1342
9 SASI_Rn01_00106861 predicted 975
10 SASI_Rn01_00106862 predicted 252
11 SASI_Rn01_00106859 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184515 predicted 815
2 SASI_Mm01_00184516 predicted 656
3 SASI_Mm01_00184517 predicted 670
4 SASI_Mm01_00184519 predicted 746
5 SASI_Mm01_00184520 predicted 1025
6 SASI_Mm02_00288669 predicted 927
7 SASI_Mm01_00184522 predicted 724
8 SASI_Mm01_00184523 predicted 832
9 SASI_Mm01_00184524 predicted 1207
10 SASI_Mm02_00288670 predicted 751
11 SASI_Mm01_00184518 predicted 292
12 SASI_Mm01_00184521 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306148 predicted 1188
2 SASI_Mm02_00306149 predicted 1021
3 SASI_Mm02_00306150 predicted 1032
4 SASI_Mm02_00306151 predicted 1121
5 SASI_Mm02_00306152 predicted 1398
6 SASI_Mm02_00306153 predicted 1302
7 SASI_Mm02_00306154 predicted 1094
8 SASI_Mm02_00306155 predicted 1204
9 SASI_Mm02_00306156 predicted 1574
10 SASI_Mm02_00306157 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145259
VALIDATED
ACVR1C MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IC
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.x-717s1c1
Sequence:CCGGCAATCTGGTAAATGCTGGAAACTCGAGTTTCCAGCATTTACCAGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.x-1351s1c1
Sequence:CCGGGCTCCTGAAATGCTTGATGATCTCGAGATCATCAAGCATTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.x-590s1c1
Sequence:CCGGTCATTATTACTGTGCCTGTTTCTCGAGAAACAGGCACAGTAATAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.x-1464s1c1
Sequence:CCGGCGGAGGAATTGTTGAGGAGTACTCGAGTACTCCTCAACAATTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145259.1-454s1c1
Sequence:CCGGGCTCAAGTCTTCTGTCATAGTCTCGAGACTATGACAGAAGACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145259.1-2613s1c1
Sequence:CCGGGAACCATATCTGTTGACATTTCTCGAGAAATGTCAACAGATATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145259.1-740s1c1
Sequence:CCGGCTCTGAAAGATCTGATTTATGCTCGAGCATAAATCAGATCTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145259.1-2761s1c1
Sequence:CCGGCCCTATTTCCTTTGTACATACCTCGAGGTATGTACAAAGGAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.1-317s1c1
Sequence:CCGGGACTGAAGTGTGTATGTCTTTCTCGAGAAAGACATACACACTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145259.1-2146s1c1
Sequence:CCGGCTTTAGGTGATGCAATCTATGCTCGAGCATAGATTGCATCACCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.1-385s1c1
Sequence:CCGGGCATCAGTCATGCTAACCAATCTCGAGATTGGTTAGCATGACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.1-1680s1c1
Sequence:CCGGGAAGACTATATCTCAACTTTGCTCGAGCAAAGTTGAGATATAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145259
VALIDATED
ACVR1C MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IC
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.x-717s1c1
Sequence:CCGGCAATCTGGTAAATGCTGGAAACTCGAGTTTCCAGCATTTACCAGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.x-1351s1c1
Sequence:CCGGGCTCCTGAAATGCTTGATGATCTCGAGATCATCAAGCATTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.x-590s1c1
Sequence:CCGGTCATTATTACTGTGCCTGTTTCTCGAGAAACAGGCACAGTAATAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.x-1464s1c1
Sequence:CCGGCGGAGGAATTGTTGAGGAGTACTCGAGTACTCCTCAACAATTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145259.1-454s1c1
Sequence:CCGGGCTCAAGTCTTCTGTCATAGTCTCGAGACTATGACAGAAGACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145259.1-2613s1c1
Sequence:CCGGGAACCATATCTGTTGACATTTCTCGAGAAATGTCAACAGATATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145259.1-740s1c1
Sequence:CCGGCTCTGAAAGATCTGATTTATGCTCGAGCATAAATCAGATCTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145259.1-2761s1c1
Sequence:CCGGCCCTATTTCCTTTGTACATACCTCGAGGTATGTACAAAGGAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.1-317s1c1
Sequence:CCGGGACTGAAGTGTGTATGTCTTTCTCGAGAAAGACATACACACTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145259.1-2146s1c1
Sequence:CCGGCTTTAGGTGATGCAATCTATGCTCGAGCATAGATTGCATCACCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.1-385s1c1
Sequence:CCGGGCATCAGTCATGCTAACCAATCTCGAGATTGGTTAGCATGACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.1-1680s1c1
Sequence:CCGGGAAGACTATATCTCAACTTTGCTCGAGCAAAGTTGAGATATAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145259
VALIDATED
ACVR1C MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IC
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.x-717s1c1
Sequence:CCGGCAATCTGGTAAATGCTGGAAACTCGAGTTTCCAGCATTTACCAGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.x-1351s1c1
Sequence:CCGGGCTCCTGAAATGCTTGATGATCTCGAGATCATCAAGCATTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.x-590s1c1
Sequence:CCGGTCATTATTACTGTGCCTGTTTCTCGAGAAACAGGCACAGTAATAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.x-1464s1c1
Sequence:CCGGCGGAGGAATTGTTGAGGAGTACTCGAGTACTCCTCAACAATTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145259.1-454s1c1
Sequence:CCGGGCTCAAGTCTTCTGTCATAGTCTCGAGACTATGACAGAAGACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145259.1-2613s1c1
Sequence:CCGGGAACCATATCTGTTGACATTTCTCGAGAAATGTCAACAGATATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145259.1-740s1c1
Sequence:CCGGCTCTGAAAGATCTGATTTATGCTCGAGCATAAATCAGATCTTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145259.1-2761s1c1
Sequence:CCGGCCCTATTTCCTTTGTACATACCTCGAGGTATGTACAAAGGAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.1-317s1c1
Sequence:CCGGGACTGAAGTGTGTATGTCTTTCTCGAGAAAGACATACACACTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145259.1-2146s1c1
Sequence:CCGGCTTTAGGTGATGCAATCTATGCTCGAGCATAGATTGCATCACCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145259.1-385s1c1
Sequence:CCGGGCATCAGTCATGCTAACCAATCTCGAGATTGGTTAGCATGACTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145259.1-1680s1c1
Sequence:CCGGGAAGACTATATCTCAACTTTGCTCGAGCAAAGTTGAGATATAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194020
ACVR1C MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IC
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1186s1c1
Sequence:CCGGGCTCCCGAAATGCTTGATGATCTCGAGATCATCAAGCATTTCGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1041s1c1
Sequence:CCGGCCGAGATATAAAGTCAAAGAACTCGAGTTCTTTGACTTTATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1320s1c1
Sequence:CCGGCCAGTTGCCTTACTATGACATCTCGAGATGTCATAGTAAGGCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-278s1c1
Sequence:CCGGCGGAACTAAATGCTCAGGTCTCTCGAGAGACCTGAGCATTTAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-652s1c1
Sequence:CCGGGCAAGGACAATTGTACTTCAACTCGAGTTGAAGTACAATTGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194020
ACVR1C MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IC
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1186s1c1
Sequence:CCGGGCTCCCGAAATGCTTGATGATCTCGAGATCATCAAGCATTTCGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1041s1c1
Sequence:CCGGCCGAGATATAAAGTCAAAGAACTCGAGTTCTTTGACTTTATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1320s1c1
Sequence:CCGGCCAGTTGCCTTACTATGACATCTCGAGATGTCATAGTAAGGCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-278s1c1
Sequence:CCGGCGGAACTAAATGCTCAGGTCTCTCGAGAGACCTGAGCATTTAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-652s1c1
Sequence:CCGGGCAAGGACAATTGTACTTCAACTCGAGTTGAAGTACAATTGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194020
ACVR1C MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IC
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1186s1c1
Sequence:CCGGGCTCCCGAAATGCTTGATGATCTCGAGATCATCAAGCATTTCGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1041s1c1
Sequence:CCGGCCGAGATATAAAGTCAAAGAACTCGAGTTCTTTGACTTTATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-1320s1c1
Sequence:CCGGCCAGTTGCCTTACTATGACATCTCGAGATGTCATAGTAAGGCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-278s1c1
Sequence:CCGGCGGAACTAAATGCTCAGGTCTCTCGAGAGACCTGAGCATTTAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194020.3-652s1c1
Sequence:CCGGGCAAGGACAATTGTACTTCAACTCGAGTTGAAGTACAATTGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111030
ACVR1C MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IC
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-1031s21c1
Sequence:CCGGCTATTGCTCACCGAGATATAACTCGAGTTATATCTCGGTGAGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-1316s21c1
Sequence:CCGGAGTACCAGTTGCCTTACTATGCTCGAGCATAGTAAGGCAACTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111030.1-1707s21c1
Sequence:CCGGGCATGTAAAGATAACGCTAAACTCGAGTTTAGCGTTATCTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-902s21c1
Sequence:CCGGAGGGCTCCTTGTATGACTATTCTCGAGAATAGTCATACAAGGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111030
ACVR1C MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IC
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-1031s21c1
Sequence:CCGGCTATTGCTCACCGAGATATAACTCGAGTTATATCTCGGTGAGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-1316s21c1
Sequence:CCGGAGTACCAGTTGCCTTACTATGCTCGAGCATAGTAAGGCAACTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111030.1-1707s21c1
Sequence:CCGGGCATGTAAAGATAACGCTAAACTCGAGTTTAGCGTTATCTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-902s21c1
Sequence:CCGGAGGGCTCCTTGTATGACTATTCTCGAGAATAGTCATACAAGGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111030
ACVR1C MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IC
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-1031s21c1
Sequence:CCGGCTATTGCTCACCGAGATATAACTCGAGTTATATCTCGGTGAGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-1316s21c1
Sequence:CCGGAGTACCAGTTGCCTTACTATGCTCGAGCATAGTAAGGCAACTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111030.1-1707s21c1
Sequence:CCGGGCATGTAAAGATAACGCTAAACTCGAGTTTAGCGTTATCTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111030.1-902s21c1
Sequence:CCGGAGGGCTCCTTGTATGACTATTCTCGAGAATAGTCATACAAGGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks