EMAIL THIS PAGE TO A FRIEND

ACVR2A

activin A receptor, type IIA

258 Gene Product Result for
Synonyms: ACTRII ACVR2
UniProtKB ID: P27037, B2RAB8, D3DP85, Q53TH4, Q6NWV2, Q92474
Gene ID:
Human(92) Summary: This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
Mouse(11480) activin receptor IIA
Rat(29263) activin A receptor, type IIA
chicken(396324) activin A receptor, type IIA
dog(476140) activin A receptor, type IIA
domestic cat(101097750) activin A receptor, type IIA
Horse(100049823) activin A receptor, type IIA
cow(281598) activin A receptor, type IIA
sheep(443304) activin A receptor, type IIA
domestic guinea pig(100731791) activin A receptor, type IIA
naked mole-rat(101707586) activin A receptor, type IIA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001616 Rosetta Predictions human pricing
NM_031571 Rosetta Predictions rat pricing
NM_007396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034744 predicted 1167
2 SASI_Hs01_00034745 predicted 1008
3 SASI_Hs02_00332174 predicted 1698
4 SASI_Hs01_00034746 predicted 1023
5 SASI_Hs01_00034747 predicted 705
6 SASI_Hs01_00034748 predicted 985
7 SASI_Hs01_00034749 predicted 1057
8 SASI_Hs01_00034750 predicted 876
9 SASI_Hs01_00034751 predicted 989
10 SASI_Hs01_00034752 predicted 717
11 SASI_Hs01_00034753 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264823 predicted 706
2 SASI_Rn01_00113651 predicted 832
3 SASI_Rn02_00264824 predicted 1028
4 SASI_Rn01_00113652 predicted 1089
5 SASI_Rn01_00113653 predicted 578
6 SASI_Rn01_00113654 predicted 583
7 SASI_Rn01_00113656 predicted 928
8 SASI_Rn01_00113657 predicted 900
9 SASI_Rn01_00113658 predicted 910
10 SASI_Rn01_00113659 predicted 697
11 SASI_Rn01_00113650 predicted 876
12 SASI_Rn01_00113655 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033650 predicted 1348
2 SASI_Mm01_00033651 predicted 1676
3 SASI_Mm01_00033652 predicted 1731
4 SASI_Mm01_00033653 predicted 2259
5 SASI_Mm01_00033654 predicted 1334
6 SASI_Mm01_00033655 predicted 1568
7 SASI_Mm01_00033656 predicted 1535
8 SASI_Mm01_00033657 predicted 1496
9 SASI_Mm01_00033658 predicted 1266
10 SASI_Mm01_00033659 predicted 1512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007396
VALIDATED
ACVR2A MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IIA
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1770s21c1
Sequence:CCGGGGTGTTGGAGGGTGCTATAAACTCGAGTTTATAGCACCCTCCAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1449s21c1
Sequence:CCGGCCTGTGGCTAATCACAGCATTCTCGAGAATGCTGTGATTAGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-2493s21c1
Sequence:CCGGGACCTGGCTAATCAAGTATTTCTCGAGAAATACTTGATTAGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1552s21c1
Sequence:CCGGGCTAGAGGATTGGCATATTTACTCGAGTAAATATGCCAATCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1288s21c1
Sequence:CCGGGCCCAGTTGCTCAATGAATATCTCGAGATATTCATTGAGCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-1241s1c1
Sequence:CCGGGCCCAGTTGCTCAATGAATATCTCGAGATATTCATTGAGCAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-2135s1c1
Sequence:CCGGCCTCCCAAAGAATCTAGTCTACTCGAGTAGACTAGATTCTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-932s1c1
Sequence:CCGGGAGGGCAATATGTGTAATGAACTCGAGTTCATTACACATATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007396.2-1505s1c1
Sequence:CCGGGCTAGAGGATTGGCATATTTACTCGAGTAAATATGCCAATCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007396
VALIDATED
ACVR2A MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IIA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1770s21c1
Sequence:CCGGGGTGTTGGAGGGTGCTATAAACTCGAGTTTATAGCACCCTCCAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1449s21c1
Sequence:CCGGCCTGTGGCTAATCACAGCATTCTCGAGAATGCTGTGATTAGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-2493s21c1
Sequence:CCGGGACCTGGCTAATCAAGTATTTCTCGAGAAATACTTGATTAGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1552s21c1
Sequence:CCGGGCTAGAGGATTGGCATATTTACTCGAGTAAATATGCCAATCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1288s21c1
Sequence:CCGGGCCCAGTTGCTCAATGAATATCTCGAGATATTCATTGAGCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-1241s1c1
Sequence:CCGGGCCCAGTTGCTCAATGAATATCTCGAGATATTCATTGAGCAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-2135s1c1
Sequence:CCGGCCTCCCAAAGAATCTAGTCTACTCGAGTAGACTAGATTCTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-932s1c1
Sequence:CCGGGAGGGCAATATGTGTAATGAACTCGAGTTCATTACACATATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007396.2-1505s1c1
Sequence:CCGGGCTAGAGGATTGGCATATTTACTCGAGTAAATATGCCAATCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007396
VALIDATED
ACVR2A MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IIA
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1770s21c1
Sequence:CCGGGGTGTTGGAGGGTGCTATAAACTCGAGTTTATAGCACCCTCCAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1449s21c1
Sequence:CCGGCCTGTGGCTAATCACAGCATTCTCGAGAATGCTGTGATTAGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-2493s21c1
Sequence:CCGGGACCTGGCTAATCAAGTATTTCTCGAGAAATACTTGATTAGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1552s21c1
Sequence:CCGGGCTAGAGGATTGGCATATTTACTCGAGTAAATATGCCAATCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007396.4-1288s21c1
Sequence:CCGGGCCCAGTTGCTCAATGAATATCTCGAGATATTCATTGAGCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-1241s1c1
Sequence:CCGGGCCCAGTTGCTCAATGAATATCTCGAGATATTCATTGAGCAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-2135s1c1
Sequence:CCGGCCTCCCAAAGAATCTAGTCTACTCGAGTAGACTAGATTCTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007396.2-932s1c1
Sequence:CCGGGAGGGCAATATGTGTAATGAACTCGAGTTCATTACACATATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007396.2-1505s1c1
Sequence:CCGGGCTAGAGGATTGGCATATTTACTCGAGTAAATATGCCAATCCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001616
VALIDATED
ACVR2A MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IIA
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-285s21c1
Sequence:CCGGACTGGTGTTGAACCGTGTTATCTCGAGATAACACGGTTCAACACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001616.3-1040s21c1
Sequence:CCGGGGCTAGAGGATTGGCATATTTCTCGAGAAATATGCCAATCCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001616.3-4379s21c1
Sequence:CCGGTAACCAGTGTTCGGCTTTATTCTCGAGAATAAAGCCGAACACTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-1259s21c1
Sequence:CCGGGGTATTAGAGGGTGCTATAAACTCGAGTTTATAGCACCCTCTAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-778s21c1
Sequence:CCGGCCCAGTTGCTTAACGAATATGCTCGAGCATATTCGTTAAGCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001616.3-2825s1c1
Sequence:CCGGGCTATGAGACTTGTAACTTTACTCGAGTAAAGTTACAAGTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-699s1c1
Sequence:CCGGCCTTCTCCATTACTAGGTTTGCTCGAGCAAACCTAGTAATGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-298s1c1
Sequence:CCGGCGTGTTATGGTGACAAAGATACTCGAGTATCTTTGTCACCATAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-1377s1c1
Sequence:CCGGGATGAATACATGTTGCCATTTCTCGAGAAATGGCAACATGTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001616.x-1448s1c1
Sequence:CCGGCAGGAAGTTGTTGTGCATAAACTCGAGTTTATGCACAACAACTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001616.x-568s1c1
Sequence:CCGGCTATTACAACATCCTGCTCTACTCGAGTAGAGCAGGATGTTGTAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001616.x-2060s1c1
Sequence:CCGGCCTTAAATGAACTACTGCTATCTCGAGATAGCAGTAGTTCATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001616.x-1004s1c1
Sequence:CCGGGCTAATGTGGTCTCTTGGAATCTCGAGATTCCAAGAGACCACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001616
VALIDATED
ACVR2A MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IIA
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-285s21c1
Sequence:CCGGACTGGTGTTGAACCGTGTTATCTCGAGATAACACGGTTCAACACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001616.3-1040s21c1
Sequence:CCGGGGCTAGAGGATTGGCATATTTCTCGAGAAATATGCCAATCCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001616.3-4379s21c1
Sequence:CCGGTAACCAGTGTTCGGCTTTATTCTCGAGAATAAAGCCGAACACTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-1259s21c1
Sequence:CCGGGGTATTAGAGGGTGCTATAAACTCGAGTTTATAGCACCCTCTAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-778s21c1
Sequence:CCGGCCCAGTTGCTTAACGAATATGCTCGAGCATATTCGTTAAGCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001616.3-2825s1c1
Sequence:CCGGGCTATGAGACTTGTAACTTTACTCGAGTAAAGTTACAAGTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-699s1c1
Sequence:CCGGCCTTCTCCATTACTAGGTTTGCTCGAGCAAACCTAGTAATGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-298s1c1
Sequence:CCGGCGTGTTATGGTGACAAAGATACTCGAGTATCTTTGTCACCATAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-1377s1c1
Sequence:CCGGGATGAATACATGTTGCCATTTCTCGAGAAATGGCAACATGTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001616.x-1448s1c1
Sequence:CCGGCAGGAAGTTGTTGTGCATAAACTCGAGTTTATGCACAACAACTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001616.x-568s1c1
Sequence:CCGGCTATTACAACATCCTGCTCTACTCGAGTAGAGCAGGATGTTGTAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001616.x-2060s1c1
Sequence:CCGGCCTTAAATGAACTACTGCTATCTCGAGATAGCAGTAGTTCATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001616.x-1004s1c1
Sequence:CCGGGCTAATGTGGTCTCTTGGAATCTCGAGATTCCAAGAGACCACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001616
VALIDATED
ACVR2A MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IIA
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-285s21c1
Sequence:CCGGACTGGTGTTGAACCGTGTTATCTCGAGATAACACGGTTCAACACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001616.3-1040s21c1
Sequence:CCGGGGCTAGAGGATTGGCATATTTCTCGAGAAATATGCCAATCCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001616.3-4379s21c1
Sequence:CCGGTAACCAGTGTTCGGCTTTATTCTCGAGAATAAAGCCGAACACTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-1259s21c1
Sequence:CCGGGGTATTAGAGGGTGCTATAAACTCGAGTTTATAGCACCCTCTAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001616.3-778s21c1
Sequence:CCGGCCCAGTTGCTTAACGAATATGCTCGAGCATATTCGTTAAGCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001616.3-2825s1c1
Sequence:CCGGGCTATGAGACTTGTAACTTTACTCGAGTAAAGTTACAAGTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-699s1c1
Sequence:CCGGCCTTCTCCATTACTAGGTTTGCTCGAGCAAACCTAGTAATGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-298s1c1
Sequence:CCGGCGTGTTATGGTGACAAAGATACTCGAGTATCTTTGTCACCATAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001616.3-1377s1c1
Sequence:CCGGGATGAATACATGTTGCCATTTCTCGAGAAATGGCAACATGTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001616.x-1448s1c1
Sequence:CCGGCAGGAAGTTGTTGTGCATAAACTCGAGTTTATGCACAACAACTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001616.x-568s1c1
Sequence:CCGGCTATTACAACATCCTGCTCTACTCGAGTAGAGCAGGATGTTGTAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001616.x-2060s1c1
Sequence:CCGGCCTTAAATGAACTACTGCTATCTCGAGATAGCAGTAGTTCATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001616.x-1004s1c1
Sequence:CCGGGCTAATGTGGTCTCTTGGAATCTCGAGATTCCAAGAGACCACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks