EMAIL THIS PAGE TO A FRIEND

ACVRL1

activin A receptor type II-like 1

88 Gene Product Result for
Synonyms: ACVRLK1 ALK-1 ALK1 HHT HHT2 ORW2 SKR3 TSR-I
UniProtKB ID: P37023, A6NGA8
Gene ID:
Human(94) Summary: This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]
Mouse(11482) activin A receptor, type II-like 1
Rat(25237) activin A receptor type II-like 1
Zebrafish(266753) activin A receptor type II-like 1
domestic cat(101097406) activin A receptor type II-like 1
cow(534536) activin A receptor type II-like 1
Horse(100061313) activin A receptor type II-like 1
domestic cat(100135773) activin A receptor type II-like 1
dog(477603) activin A receptor type II-like 1
chicken(100857446) activin A receptor type II-like 1
sheep(101114095) activin A receptor type II-like 1
domestic guinea pig(100716392) activin A receptor type II-like 1
naked mole-rat(101709807) activin A receptor type II-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A0226 Anti-Activin Receptor-Like Kinase 1 antibody produced in goat affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4503630 Anti-ACVL1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2501916 Anti-ACVRL1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1412000 ANTI-ACVRL1 antibody produced in mouse clone 5F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412001 ANTI-ACVRL1 antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412002 ANTI-ACVRL1 antibody produced in mouse clone 1E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA007041 Anti-ACVRL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV44199 Anti-ACVRL1 antibody produced in rabbit affinity isolated antibody rat, horse, human, canine, mouse
western blot pricing
SAB1304748 ANTI-MOUSE ACVRL1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0000094M1 Monoclonal Anti-ACVRL1 antibody produced in mouse clone 5B1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403524 Monoclonal Anti-ACVRL1 antibody produced in mouse clone 7H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000020 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000020 Rosetta Predictions human pricing
NM_001077401 Rosetta Predictions human pricing
NM_022441 Rosetta Predictions rat pricing
NM_009612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301679 predicted 2281
2 SASI_Hs01_00113768 predicted 1133
3 SASI_Hs02_00301680 predicted 2249
4 SASI_Hs01_00113771 predicted 1246
5 SASI_Hs01_00113772 predicted 1345
6 SASI_Hs01_00113774 predicted 1535
7 SASI_Hs02_00301681 predicted 2091
8 SASI_Hs01_00113775 predicted 1330
9 SASI_Hs01_00113776 predicted 749
10 SASI_Hs01_00113777 predicted 992
11 SASI_Hs01_00113769 predicted 1131
12 SASI_Hs01_00113770 predicted 1011
13 SASI_Hs01_00113773 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312484 predicted 2140
2 SASI_Hs02_00312485 predicted 988
3 SASI_Hs02_00312486 predicted 2106
4 SASI_Hs02_00312487 predicted 1116
5 SASI_Hs02_00312488 predicted 1204
6 SASI_Hs02_00312489 predicted 1398
7 SASI_Hs02_00312490 predicted 1948
8 SASI_Hs02_00312491 predicted 1196
9 SASI_Hs02_00312492 predicted 618
10 SASI_Hs02_00312493 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045340 predicted 1212
2 SASI_Rn01_00045341 predicted 1701
3 SASI_Rn01_00045342 predicted 1586
4 SASI_Rn01_00045343 predicted 1213
5 SASI_Rn01_00045344 predicted 1669
6 SASI_Rn02_00263183 predicted 404
7 SASI_Rn01_00045345 predicted 990
8 SASI_Rn01_00045346 predicted 724
9 SASI_Rn01_00045348 predicted 916
10 SASI_Rn01_00045349 predicted 885
11 SASI_Rn01_00045347 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114603 predicted 1255
2 SASI_Mm02_00316546 predicted 2208
3 SASI_Mm01_00114604 predicted 1807
4 SASI_Mm01_00114605 predicted 1701
5 SASI_Mm01_00114606 predicted 1103
6 SASI_Mm01_00114607 predicted 519
7 SASI_Mm01_00114608 predicted 1084
8 SASI_Mm01_00114609 predicted 996
9 SASI_Mm01_00114610 predicted 1915
10 SASI_Mm01_00114611 predicted 1427
11 SASI_Mm01_00114612 predicted 1739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009612
VALIDATED
ACVRL1 MISSION shRNA Bacterial Glycerol Stock
activin A receptor type II-like 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-1273s21c1
Sequence:CCGGGTAACTTGCAGTGTTGCATTGCTCGAGCAATGCAACACTGCAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-1240s21c1
Sequence:CCGGGTGACCTCAAGAGTCGCAATGCTCGAGCATTGCGACTCTTGAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-925s21c1
Sequence:CCGGAGAGTGTGGCGGTCAAGATTTCTCGAGAAATCTTGACCGCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1317s21c1
Sequence:CCGGCACTCACAAAGCAGCGATTACCTCGAGGTAATCGCTGCTTTGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1189s21c1
Sequence:CCGGACCTACATGTGGAGATCTTTGCTCGAGCAAAGATCTCCACATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-873s21c1
Sequence:CCGGTGTGTGGGAAAGGGCCGATATCTCGAGATATCGGCCCTTTCCCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-2902s21c1
Sequence:CCGGACACAGAGAGTCTGGTATTTACTCGAGTAAATACCAGACTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1701s21c1
Sequence:CCGGCTGCGCATAAAGAAGACATTGCTCGAGCAATGTCTTCTTTATGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-512s1c1
Sequence:CCGGCCCACAGAGTTTCTGAACCATCTCGAGATGGTTCAGAAACTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009612.1-1762s1c1
Sequence:CCGGGAAGCCCAAAGTGATTCACTACTCGAGTAGTGAATCACTTTGGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-538s1c1
Sequence:CCGGCTGCTATAGATCCTTCTGCAACTCGAGTTGCAGAAGGATCTATAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-1333s1c1
Sequence:CCGGGCACTCACAAAGCAGCGATTACTCGAGTAATCGCTGCTTTGTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009612.1-1538s1c1
Sequence:CCGGCCACCTTTCTATGACATGGTACTCGAGTACCATGTCATAGAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009612
VALIDATED
ACVRL1 MISSION shRNA shRNA Plasmid DNA
activin A receptor type II-like 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-1273s21c1
Sequence:CCGGGTAACTTGCAGTGTTGCATTGCTCGAGCAATGCAACACTGCAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-1240s21c1
Sequence:CCGGGTGACCTCAAGAGTCGCAATGCTCGAGCATTGCGACTCTTGAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-925s21c1
Sequence:CCGGAGAGTGTGGCGGTCAAGATTTCTCGAGAAATCTTGACCGCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1317s21c1
Sequence:CCGGCACTCACAAAGCAGCGATTACCTCGAGGTAATCGCTGCTTTGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1189s21c1
Sequence:CCGGACCTACATGTGGAGATCTTTGCTCGAGCAAAGATCTCCACATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-873s21c1
Sequence:CCGGTGTGTGGGAAAGGGCCGATATCTCGAGATATCGGCCCTTTCCCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-2902s21c1
Sequence:CCGGACACAGAGAGTCTGGTATTTACTCGAGTAAATACCAGACTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1701s21c1
Sequence:CCGGCTGCGCATAAAGAAGACATTGCTCGAGCAATGTCTTCTTTATGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-512s1c1
Sequence:CCGGCCCACAGAGTTTCTGAACCATCTCGAGATGGTTCAGAAACTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009612.1-1762s1c1
Sequence:CCGGGAAGCCCAAAGTGATTCACTACTCGAGTAGTGAATCACTTTGGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-538s1c1
Sequence:CCGGCTGCTATAGATCCTTCTGCAACTCGAGTTGCAGAAGGATCTATAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-1333s1c1
Sequence:CCGGGCACTCACAAAGCAGCGATTACTCGAGTAATCGCTGCTTTGTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009612.1-1538s1c1
Sequence:CCGGCCACCTTTCTATGACATGGTACTCGAGTACCATGTCATAGAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009612
VALIDATED
ACVRL1 MISSION shRNA Lentiviral Transduction Particles
activin A receptor type II-like 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-1273s21c1
Sequence:CCGGGTAACTTGCAGTGTTGCATTGCTCGAGCAATGCAACACTGCAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-1240s21c1
Sequence:CCGGGTGACCTCAAGAGTCGCAATGCTCGAGCATTGCGACTCTTGAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009612.2-925s21c1
Sequence:CCGGAGAGTGTGGCGGTCAAGATTTCTCGAGAAATCTTGACCGCCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1317s21c1
Sequence:CCGGCACTCACAAAGCAGCGATTACCTCGAGGTAATCGCTGCTTTGTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1189s21c1
Sequence:CCGGACCTACATGTGGAGATCTTTGCTCGAGCAAAGATCTCCACATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-873s21c1
Sequence:CCGGTGTGTGGGAAAGGGCCGATATCTCGAGATATCGGCCCTTTCCCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-2902s21c1
Sequence:CCGGACACAGAGAGTCTGGTATTTACTCGAGTAAATACCAGACTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009612.2-1701s21c1
Sequence:CCGGCTGCGCATAAAGAAGACATTGCTCGAGCAATGTCTTCTTTATGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-512s1c1
Sequence:CCGGCCCACAGAGTTTCTGAACCATCTCGAGATGGTTCAGAAACTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009612.1-1762s1c1
Sequence:CCGGGAAGCCCAAAGTGATTCACTACTCGAGTAGTGAATCACTTTGGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-538s1c1
Sequence:CCGGCTGCTATAGATCCTTCTGCAACTCGAGTTGCAGAAGGATCTATAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009612.1-1333s1c1
Sequence:CCGGGCACTCACAAAGCAGCGATTACTCGAGTAATCGCTGCTTTGTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009612.1-1538s1c1
Sequence:CCGGCCACCTTTCTATGACATGGTACTCGAGTACCATGTCATAGAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000020
ACVRL1 MISSION shRNA Bacterial Glycerol Stock
activin A receptor type II-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-1224s1c1
Sequence:CCGGCGTGGAGATCTTCGGTACACACTCGAGTGTGTACCGAAGATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-750s1c1
Sequence:CCGGGCTGGGAGAGTCCAGTCTCATCTCGAGATGAGACTGGACTCTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-1002s1c1
Sequence:CCGGCCGGGAGACTGAGATCTATAACTCGAGTTATAGATCTCAGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000020.1-1797s1c1
Sequence:CCGGCAGGAGCACCTGATTCCTTTCCTCGAGGAAAGGAATCAGGTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1729s1c1
Sequence:CCGGCTGCGGATCAAGAAGACACTACTCGAGTAGTGTCTTCTTGATCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1361s1c1
Sequence:CCGGATTACCTGGACATCGGCAACACTCGAGTGTTGCCGATGTCCAGGTAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1767s1c1
Sequence:CCGGTCCAGAGAAGCCTAAAGTGATCTCGAGATCACTTTAGGCTTCTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1764s1c1
Sequence:CCGGCAGTCCAGAGAAGCCTAAAGTCTCGAGACTTTAGGCTTCTCTGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000020
ACVRL1 MISSION shRNA shRNA Plasmid DNA
activin A receptor type II-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-1224s1c1
Sequence:CCGGCGTGGAGATCTTCGGTACACACTCGAGTGTGTACCGAAGATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-750s1c1
Sequence:CCGGGCTGGGAGAGTCCAGTCTCATCTCGAGATGAGACTGGACTCTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-1002s1c1
Sequence:CCGGCCGGGAGACTGAGATCTATAACTCGAGTTATAGATCTCAGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000020.1-1797s1c1
Sequence:CCGGCAGGAGCACCTGATTCCTTTCCTCGAGGAAAGGAATCAGGTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1729s1c1
Sequence:CCGGCTGCGGATCAAGAAGACACTACTCGAGTAGTGTCTTCTTGATCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1361s1c1
Sequence:CCGGATTACCTGGACATCGGCAACACTCGAGTGTTGCCGATGTCCAGGTAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1767s1c1
Sequence:CCGGTCCAGAGAAGCCTAAAGTGATCTCGAGATCACTTTAGGCTTCTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1764s1c1
Sequence:CCGGCAGTCCAGAGAAGCCTAAAGTCTCGAGACTTTAGGCTTCTCTGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000020
ACVRL1 MISSION shRNA Lentiviral Transduction Particles
activin A receptor type II-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-1224s1c1
Sequence:CCGGCGTGGAGATCTTCGGTACACACTCGAGTGTGTACCGAAGATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-750s1c1
Sequence:CCGGGCTGGGAGAGTCCAGTCTCATCTCGAGATGAGACTGGACTCTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000020.1-1002s1c1
Sequence:CCGGCCGGGAGACTGAGATCTATAACTCGAGTTATAGATCTCAGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000020.1-1797s1c1
Sequence:CCGGCAGGAGCACCTGATTCCTTTCCTCGAGGAAAGGAATCAGGTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1729s1c1
Sequence:CCGGCTGCGGATCAAGAAGACACTACTCGAGTAGTGTCTTCTTGATCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1361s1c1
Sequence:CCGGATTACCTGGACATCGGCAACACTCGAGTGTTGCCGATGTCCAGGTAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1767s1c1
Sequence:CCGGTCCAGAGAAGCCTAAAGTGATCTCGAGATCACTTTAGGCTTCTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000020.x-1764s1c1
Sequence:CCGGCAGTCCAGAGAAGCCTAAAGTCTCGAGACTTTAGGCTTCTCTGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks