EMAIL THIS PAGE TO A FRIEND

ACY1

aminoacylase 1

68 Gene Product Result for
Synonyms: ACY-1 ACY1D
UniProtKB ID: Q03154, C9J6I6, C9J9D8, C9JWD4
Gene ID:
Human(95) Summary: This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]
Mouse(109652) aminoacylase 1
Rat(300981) aminoacylase 1
Zebrafish(393970) aminoacylase 1
dog(476602) aminoacylase 1
cow(768058) aminoacylase 1
Horse(100060631) aminoacylase 1
chicken(100858836) aminoacylase 1
naked mole-rat(101696409) aminoacylase 1
sheep(101113801) aminoacylase 1
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A6609 Anti-ACY1 (306-320) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A6484 Anti-ACY1 (86-100) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22335A Anti-ACY1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
GW22335B Anti-ACY1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1405423 Anti-ACY1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA036174 Anti-ACY1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA036175 Anti-ACY1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0000095M1 Monoclonal Anti-ACY1 antibody produced in mouse clone 4F1-B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403525 Monoclonal Anti-ACY1 antibody produced in mouse clone 1A11-F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100423 Monoclonal Anti-ACY1 antibody produced in mouse clone ACY1-A356, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000666 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000666 Rosetta Predictions human pricing
NM_001005383 Rosetta Predictions rat pricing
XM_579142 Rosetta Predictions rat pricing
NM_025371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167396 predicted 862
2 SASI_Hs01_00167397 predicted 802
3 SASI_Hs01_00167398 predicted 389
4 SASI_Hs01_00167399 predicted 274
5 SASI_Hs01_00167400 predicted 798
6 SASI_Hs01_00167401 predicted 859
7 SASI_Hs01_00167403 predicted 1000
8 SASI_Hs01_00167404 predicted 230
9 SASI_Hs01_00167405 predicted 506
10 SASI_Hs02_00303027 predicted 1127
11 SASI_Hs01_00167402 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072515 predicted 1103
2 SASI_Rn01_00072516 predicted 536
3 SASI_Rn01_00072517 predicted 642
4 SASI_Rn01_00072518 predicted 299
5 SASI_Rn01_00072519 predicted 936
6 SASI_Rn01_00072520 predicted 1099
7 SASI_Rn01_00072521 predicted 1088
8 SASI_Rn01_00072522 predicted 742
9 SASI_Rn01_00072523 predicted 642
10 SASI_Rn01_00072524 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145691 predicted 1007
2 SASI_Rn01_00145692 predicted 1029
3 SASI_Rn01_00145693 predicted 1098
4 SASI_Rn01_00145694 predicted 1102
5 SASI_Rn01_00145695 predicted 1096
6 SASI_Rn01_00145696 predicted 1040
7 SASI_Rn01_00145697 predicted 1099
8 SASI_Rn01_00145698 predicted 1043
9 SASI_Rn01_00145699 predicted 1094
10 SASI_Rn01_00145700 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061170 predicted 411
2 SASI_Mm01_00061171 predicted 914
3 SASI_Mm01_00061172 predicted 688
4 SASI_Mm01_00061173 predicted 762
5 SASI_Mm01_00061174 predicted 358
6 SASI_Mm01_00061175 predicted 690
7 SASI_Mm01_00061176 predicted 1075
8 SASI_Mm01_00061177 predicted 905
9 SASI_Mm02_00328090 predicted 878
10 SASI_Mm01_00061178 predicted 961
11 SASI_Mm01_00061179 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025371
VALIDATED
ACY1 MISSION shRNA Bacterial Glycerol Stock
aminoacylase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-1252s1c1
Sequence:CCGGCGGCTGCATGAGGATATATTTCTCGAGAAATATATCCTCATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-462s1c1
Sequence:CCGGGAAGAGTGTCAGCATCCAGTACTCGAGTACTGGATGCTGACACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-1228s1c1
Sequence:CCGGGTCCTGCTACATGACCATAATCTCGAGATTATGGTCATGTAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-777s1c1
Sequence:CCGGGCATAAGGTTATAAGCTCCATCTCGAGATGGAGCTTATAACCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025371.2-888s21c1
Sequence:CCGGGAAGGTGGCGTGGCCTATAATCTCGAGATTATAGGCCACGCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025371.2-1251s21c1
Sequence:CCGGCGGCTGCATGAGGATATATTTCTCGAGAAATATATCCTCATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025371.2-1154s21c1
Sequence:CCGGTGCCACTGACAGCCGCTTTATCTCGAGATAAAGCGGCTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025371.2-1227s21c1
Sequence:CCGGGTCCTGCTACATGACCATAATCTCGAGATTATGGTCATGTAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025371
VALIDATED
ACY1 MISSION shRNA shRNA Plasmid DNA
aminoacylase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-1252s1c1
Sequence:CCGGCGGCTGCATGAGGATATATTTCTCGAGAAATATATCCTCATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-462s1c1
Sequence:CCGGGAAGAGTGTCAGCATCCAGTACTCGAGTACTGGATGCTGACACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-1228s1c1
Sequence:CCGGGTCCTGCTACATGACCATAATCTCGAGATTATGGTCATGTAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-777s1c1
Sequence:CCGGGCATAAGGTTATAAGCTCCATCTCGAGATGGAGCTTATAACCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025371.2-888s21c1
Sequence:CCGGGAAGGTGGCGTGGCCTATAATCTCGAGATTATAGGCCACGCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025371.2-1251s21c1
Sequence:CCGGCGGCTGCATGAGGATATATTTCTCGAGAAATATATCCTCATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025371.2-1154s21c1
Sequence:CCGGTGCCACTGACAGCCGCTTTATCTCGAGATAAAGCGGCTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025371.2-1227s21c1
Sequence:CCGGGTCCTGCTACATGACCATAATCTCGAGATTATGGTCATGTAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025371
VALIDATED
ACY1 MISSION shRNA Lentiviral Transduction Particles
aminoacylase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-1252s1c1
Sequence:CCGGCGGCTGCATGAGGATATATTTCTCGAGAAATATATCCTCATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-462s1c1
Sequence:CCGGGAAGAGTGTCAGCATCCAGTACTCGAGTACTGGATGCTGACACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-1228s1c1
Sequence:CCGGGTCCTGCTACATGACCATAATCTCGAGATTATGGTCATGTAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025371.1-777s1c1
Sequence:CCGGGCATAAGGTTATAAGCTCCATCTCGAGATGGAGCTTATAACCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025371.2-888s21c1
Sequence:CCGGGAAGGTGGCGTGGCCTATAATCTCGAGATTATAGGCCACGCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025371.2-1251s21c1
Sequence:CCGGCGGCTGCATGAGGATATATTTCTCGAGAAATATATCCTCATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025371.2-1154s21c1
Sequence:CCGGTGCCACTGACAGCCGCTTTATCTCGAGATAAAGCGGCTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025371.2-1227s21c1
Sequence:CCGGGTCCTGCTACATGACCATAATCTCGAGATTATGGTCATGTAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000666
VALIDATED
ACY1 MISSION shRNA Bacterial Glycerol Stock
aminoacylase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-718s1c1
Sequence:CCGGGCACAAGGTTGTAAACTCCATCTCGAGATGGAGTTTACAACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-964s1c1
Sequence:CCGGCACCCTAGAGTTTGCTCAGAACTCGAGTTCTGAGCAAACTCTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000666.1-1096s1c1
Sequence:CCGGTGCCACTGACAACCGCTATATCTCGAGATATAGCGGTTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-479s1c1
Sequence:CCGGCACATGACCTTTGTGCCTGATCTCGAGATCAGGCACAAAGGTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-311s1c1
Sequence:CCGGGTGCCTGTCTTCAAGGAACATCTCGAGATGTTCCTTGAAGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-1096s21c1
Sequence:CCGGTGCCACTGACAACCGCTATATCTCGAGATATAGCGGTTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-311s21c1
Sequence:CCGGGTGCCTGTCTTCAAGGAACATCTCGAGATGTTCCTTGAAGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-964s21c1
Sequence:CCGGCACCCTAGAGTTTGCTCAGAACTCGAGTTCTGAGCAAACTCTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-479s21c1
Sequence:CCGGCACATGACCTTTGTGCCTGATCTCGAGATCAGGCACAAAGGTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-718s21c1
Sequence:CCGGGCACAAGGTTGTAAACTCCATCTCGAGATGGAGTTTACAACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000666
VALIDATED
ACY1 MISSION shRNA shRNA Plasmid DNA
aminoacylase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-718s1c1
Sequence:CCGGGCACAAGGTTGTAAACTCCATCTCGAGATGGAGTTTACAACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-964s1c1
Sequence:CCGGCACCCTAGAGTTTGCTCAGAACTCGAGTTCTGAGCAAACTCTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000666.1-1096s1c1
Sequence:CCGGTGCCACTGACAACCGCTATATCTCGAGATATAGCGGTTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-479s1c1
Sequence:CCGGCACATGACCTTTGTGCCTGATCTCGAGATCAGGCACAAAGGTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-311s1c1
Sequence:CCGGGTGCCTGTCTTCAAGGAACATCTCGAGATGTTCCTTGAAGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-1096s21c1
Sequence:CCGGTGCCACTGACAACCGCTATATCTCGAGATATAGCGGTTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-311s21c1
Sequence:CCGGGTGCCTGTCTTCAAGGAACATCTCGAGATGTTCCTTGAAGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-964s21c1
Sequence:CCGGCACCCTAGAGTTTGCTCAGAACTCGAGTTCTGAGCAAACTCTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-479s21c1
Sequence:CCGGCACATGACCTTTGTGCCTGATCTCGAGATCAGGCACAAAGGTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-718s21c1
Sequence:CCGGGCACAAGGTTGTAAACTCCATCTCGAGATGGAGTTTACAACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000666
VALIDATED
ACY1 MISSION shRNA Lentiviral Transduction Particles
aminoacylase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-718s1c1
Sequence:CCGGGCACAAGGTTGTAAACTCCATCTCGAGATGGAGTTTACAACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-964s1c1
Sequence:CCGGCACCCTAGAGTTTGCTCAGAACTCGAGTTCTGAGCAAACTCTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000666.1-1096s1c1
Sequence:CCGGTGCCACTGACAACCGCTATATCTCGAGATATAGCGGTTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-479s1c1
Sequence:CCGGCACATGACCTTTGTGCCTGATCTCGAGATCAGGCACAAAGGTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000666.1-311s1c1
Sequence:CCGGGTGCCTGTCTTCAAGGAACATCTCGAGATGTTCCTTGAAGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-1096s21c1
Sequence:CCGGTGCCACTGACAACCGCTATATCTCGAGATATAGCGGTTGTCAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-311s21c1
Sequence:CCGGGTGCCTGTCTTCAAGGAACATCTCGAGATGTTCCTTGAAGACAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-964s21c1
Sequence:CCGGCACCCTAGAGTTTGCTCAGAACTCGAGTTCTGAGCAAACTCTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-479s21c1
Sequence:CCGGCACATGACCTTTGTGCCTGATCTCGAGATCAGGCACAAAGGTCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000666.1-718s21c1
Sequence:CCGGGCACAAGGTTGTAAACTCCATCTCGAGATGGAGTTTACAACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks