EMAIL THIS PAGE TO A FRIEND

ACY3

aspartoacylase (aminocyclase) 3

58 Gene Product Result for
Synonyms: ACY-3 HCBP1
UniProtKB ID: Q96HD9
Gene ID:
Mouse(71670) aspartoacylase (aminoacylase) 3
Rat(293653) aspartoacylase (aminocyclase) 3
domestic guinea pig(100735640) aspartoacylase (aminocyclase) 3
naked mole-rat(101725542) aspartoacylase (aminocyclase) 3
domestic cat(101083207) aspartoacylase (aminocyclase) 3
dog(100683126) aspartoacylase (aminocyclase) 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080658 Rosetta Predictions human pricing
NM_001009603 Rosetta Predictions rat pricing
NM_027857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362418 predicted 248
2 SASI_Hs01_00060504 predicted 525
3 SASI_Hs01_00060505 predicted 721
4 SASI_Hs01_00060506 predicted 820
5 SASI_Hs01_00060507 predicted 657
6 SASI_Hs01_00060508 predicted 373
7 SASI_Hs01_00060509 predicted 938
8 SASI_Hs01_00060510 predicted 485
9 SASI_Hs01_00060511 predicted 767
10 SASI_Hs01_00060512 predicted 424
11 SASI_Hs01_00060513 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031153 predicted 510
2 SASI_Rn01_00031154 predicted 470
3 SASI_Rn01_00031155 predicted 504
4 SASI_Rn01_00031156 predicted 835
5 SASI_Rn01_00031157 predicted 250
6 SASI_Rn01_00031159 predicted 1017
7 SASI_Rn01_00031161 predicted 488
8 SASI_Rn02_00199612 predicted 470
9 SASI_Rn02_00199613 predicted 872
10 SASI_Rn01_00031162 predicted 480
11 SASI_Rn01_00031158 predicted 682
12 SASI_Rn01_00031160 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332810 predicted 887
2 SASI_Mm01_00049983 predicted 467
3 SASI_Mm01_00049984 predicted 487
4 SASI_Mm01_00049985 predicted 1050
5 SASI_Mm02_00332811 predicted 1284
6 SASI_Mm01_00049986 predicted 585
7 SASI_Mm01_00049987 predicted 1229
8 SASI_Mm01_00049988 predicted 1173
9 SASI_Mm01_00049989 predicted 821
10 SASI_Mm01_00049990 predicted 751
11 SASI_Mm01_00049991 predicted 784
12 SASI_Mm01_00049992 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080658
ACY3 MISSION shRNA Bacterial Glycerol Stock
aspartoacylase (aminocyclase) 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080658.1-661s21c1
Sequence:CCGGAGCTACAACCTGGACTCTGTGCTCGAGCACAGAGTCCAGGTTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080658.1-1123s21c1
Sequence:CCGGGCTTCCTAACCCAAGACACACCTCGAGGTGTGTCTTGGGTTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-1059s1c1
Sequence:CCGGCCAGACTGAGAAGTTCACATTCTCGAGAATGTGAACTTCTCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-820s1c1
Sequence:CCGGGCCTTTGAGATGGAAGCCTATCTCGAGATAGGCTTCCATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-1030s1c1
Sequence:CCGGGCCTACTATGAGAAGGGCGTTCTCGAGAACGCCCTTCTCATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-369s1c1
Sequence:CCGGCCATGACCTCAACCGCACCTTCTCGAGAAGGTGCGGTTGAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-501s1c1
Sequence:CCGGCTTTGTCCTTGACCTGCACAACTCGAGTTGTGCAGGTCAAGGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080658
ACY3 MISSION shRNA shRNA Plasmid DNA
aspartoacylase (aminocyclase) 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080658.1-661s21c1
Sequence:CCGGAGCTACAACCTGGACTCTGTGCTCGAGCACAGAGTCCAGGTTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080658.1-1123s21c1
Sequence:CCGGGCTTCCTAACCCAAGACACACCTCGAGGTGTGTCTTGGGTTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-1059s1c1
Sequence:CCGGCCAGACTGAGAAGTTCACATTCTCGAGAATGTGAACTTCTCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-820s1c1
Sequence:CCGGGCCTTTGAGATGGAAGCCTATCTCGAGATAGGCTTCCATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-1030s1c1
Sequence:CCGGGCCTACTATGAGAAGGGCGTTCTCGAGAACGCCCTTCTCATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-369s1c1
Sequence:CCGGCCATGACCTCAACCGCACCTTCTCGAGAAGGTGCGGTTGAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-501s1c1
Sequence:CCGGCTTTGTCCTTGACCTGCACAACTCGAGTTGTGCAGGTCAAGGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080658
ACY3 MISSION shRNA Lentiviral Transduction Particles
aspartoacylase (aminocyclase) 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080658.1-661s21c1
Sequence:CCGGAGCTACAACCTGGACTCTGTGCTCGAGCACAGAGTCCAGGTTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080658.1-1123s21c1
Sequence:CCGGGCTTCCTAACCCAAGACACACCTCGAGGTGTGTCTTGGGTTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-1059s1c1
Sequence:CCGGCCAGACTGAGAAGTTCACATTCTCGAGAATGTGAACTTCTCAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-820s1c1
Sequence:CCGGGCCTTTGAGATGGAAGCCTATCTCGAGATAGGCTTCCATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-1030s1c1
Sequence:CCGGGCCTACTATGAGAAGGGCGTTCTCGAGAACGCCCTTCTCATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-369s1c1
Sequence:CCGGCCATGACCTCAACCGCACCTTCTCGAGAAGGTGCGGTTGAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080658.1-501s1c1
Sequence:CCGGCTTTGTCCTTGACCTGCACAACTCGAGTTGTGCAGGTCAAGGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027857
VALIDATED
ACY3 MISSION shRNA Bacterial Glycerol Stock
aspartoacylase (aminocyclase) 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-904s21c1
Sequence:CCGGCGTGGAATCTATATCCAAGAACTCGAGTTCTTGGATATAGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-922s21c1
Sequence:CCGGGAATGGAATCTGTCTGGAGATCTCGAGATCTCCAGACAGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-784s21c1
Sequence:CCGGCCTCATCTCTGAATCCAACATCTCGAGATGTTGGATTCAGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-1032s21c1
Sequence:CCGGTCAACCAAGGCATGGACTTACCTCGAGGTAAGTCCATGCCTTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-1253s21c1
Sequence:CCGGATTAATGAGGCTGCCTATTATCTCGAGATAATAGGCAGCCTCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-904s1c1
Sequence:CCGGCGTGGAATCTATATCCAAGAACTCGAGTTCTTGGATATAGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027857.2-903s1c1
Sequence:CCGGGCGTGGAATCTATATCCAAGACTCGAGTCTTGGATATAGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027857.2-784s1c1
Sequence:CCGGCCTCATCTCTGAATCCAACATCTCGAGATGTTGGATTCAGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-1368s1c1
Sequence:CCGGCCAAATCATACCTGGCCTGATCTCGAGATCAGGCCAGGTATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-922s1c1
Sequence:CCGGGAATGGAATCTGTCTGGAGATCTCGAGATCTCCAGACAGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027857
VALIDATED
ACY3 MISSION shRNA shRNA Plasmid DNA
aspartoacylase (aminocyclase) 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-904s21c1
Sequence:CCGGCGTGGAATCTATATCCAAGAACTCGAGTTCTTGGATATAGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-922s21c1
Sequence:CCGGGAATGGAATCTGTCTGGAGATCTCGAGATCTCCAGACAGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-784s21c1
Sequence:CCGGCCTCATCTCTGAATCCAACATCTCGAGATGTTGGATTCAGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-1032s21c1
Sequence:CCGGTCAACCAAGGCATGGACTTACCTCGAGGTAAGTCCATGCCTTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-1253s21c1
Sequence:CCGGATTAATGAGGCTGCCTATTATCTCGAGATAATAGGCAGCCTCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-904s1c1
Sequence:CCGGCGTGGAATCTATATCCAAGAACTCGAGTTCTTGGATATAGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027857.2-903s1c1
Sequence:CCGGGCGTGGAATCTATATCCAAGACTCGAGTCTTGGATATAGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027857.2-784s1c1
Sequence:CCGGCCTCATCTCTGAATCCAACATCTCGAGATGTTGGATTCAGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-1368s1c1
Sequence:CCGGCCAAATCATACCTGGCCTGATCTCGAGATCAGGCCAGGTATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-922s1c1
Sequence:CCGGGAATGGAATCTGTCTGGAGATCTCGAGATCTCCAGACAGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027857
VALIDATED
ACY3 MISSION shRNA Lentiviral Transduction Particles
aspartoacylase (aminocyclase) 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-904s21c1
Sequence:CCGGCGTGGAATCTATATCCAAGAACTCGAGTTCTTGGATATAGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-922s21c1
Sequence:CCGGGAATGGAATCTGTCTGGAGATCTCGAGATCTCCAGACAGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-784s21c1
Sequence:CCGGCCTCATCTCTGAATCCAACATCTCGAGATGTTGGATTCAGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-1032s21c1
Sequence:CCGGTCAACCAAGGCATGGACTTACCTCGAGGTAAGTCCATGCCTTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027857.3-1253s21c1
Sequence:CCGGATTAATGAGGCTGCCTATTATCTCGAGATAATAGGCAGCCTCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-904s1c1
Sequence:CCGGCGTGGAATCTATATCCAAGAACTCGAGTTCTTGGATATAGATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027857.2-903s1c1
Sequence:CCGGGCGTGGAATCTATATCCAAGACTCGAGTCTTGGATATAGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027857.2-784s1c1
Sequence:CCGGCCTCATCTCTGAATCCAACATCTCGAGATGTTGGATTCAGAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-1368s1c1
Sequence:CCGGCCAAATCATACCTGGCCTGATCTCGAGATCAGGCCAGGTATGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027857.2-922s1c1
Sequence:CCGGGAATGGAATCTGTCTGGAGATCTCGAGATCTCCAGACAGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks