EMAIL THIS PAGE TO A FRIEND

ACYP1

acylphosphatase 1, erythrocyte (common) type

106 Gene Product Result for
Synonyms: ACYPE
UniProtKB ID: P07311, A6NDV8, B2R590
Gene ID:
Human(97) Summary: Acylphosphatase is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase, on the basis of their tissue localization. This gene encodes the erythrocyte acylphosphatase isoenzyme. Alternatively spliced transcript variants that encode different proteins were identified through data analysis. [provided by RefSeq, Jul 2008]
Mouse(66204) acylphosphatase 1, erythrocyte (common) type
Rat(299203) acylphosphatase 1, erythrocyte (common) type
Zebrafish(571263) acylphosphatase 1, erythrocyte (common) type
cow(507844) acylphosphatase 1, erythrocyte (common) type
domestic cat(101096992) acylphosphatase 1, erythrocyte (common) type
dog(480390) acylphosphatase 1, erythrocyte (common) type
chicken(423361) acylphosphatase 1, erythrocyte (common) type
naked mole-rat(101720710) acylphosphatase 1, erythrocyte (common) type
domestic guinea pig(100735661) acylphosphatase 1, erythrocyte (common) type
sheep(101109618) acylphosphatase 1, erythrocyte (common) type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001107 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001107 Rosetta Predictions human pricing
NM_203488 Rosetta Predictions human pricing
NM_001106746 Rosetta Predictions rat pricing
NM_025421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246447 predicted 354
2 SASI_Hs01_00246448 predicted 278
3 SASI_Hs01_00246449 predicted 298
4 SASI_Hs01_00246450 predicted 361
5 SASI_Hs01_00246451 predicted 267
6 SASI_Hs02_00324669 predicted 272
7 SASI_Hs01_00246453 predicted 293
8 SASI_Hs01_00246454 predicted 250
9 SASI_Hs02_00324670 predicted 290
10 SASI_Hs01_00246455 predicted 243
11 SASI_Hs01_00246452 predicted 345
12 SASI_Hs01_00246456 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243255 predicted 428
2 SASI_Hs01_00243257 predicted 358
3 SASI_Hs01_00243258 predicted 377
4 SASI_Hs01_00243259 predicted 434
5 SASI_Hs01_00243260 predicted 338
6 SASI_Hs01_00243261 predicted 209
7 SASI_Hs01_00243263 predicted 334
8 SASI_Hs02_00373414 predicted 223
9 SASI_Hs01_00243264 predicted 218
10 SASI_Hs02_00373415 predicted 325
11 SASI_Hs01_00243256 predicted 244
12 SASI_Hs01_00243262 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221988 predicted 470
2 SASI_Rn02_00221989 predicted 402
3 SASI_Rn02_00221990 predicted 257
4 SASI_Rn02_00221991 predicted 448
5 SASI_Rn02_00221992 predicted 465
6 SASI_Rn02_00221993 predicted 376
7 SASI_Rn02_00221994 predicted 379
8 SASI_Rn02_00221995 predicted 252
9 SASI_Rn02_00221996 predicted 468
10 SASI_Rn02_00221997 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094242 predicted 208
2 SASI_Mm01_00094243 predicted 206
3 SASI_Mm02_00328215 predicted 231
4 SASI_Mm01_00094244 predicted 207
5 SASI_Mm01_00094245 predicted 236
6 SASI_Mm01_00094246 predicted 233
7 SASI_Mm01_00094247 predicted 264
8 SASI_Mm01_00094248 predicted 204
9 SASI_Mm02_00328216 predicted 226
10 SASI_Mm01_00094249 predicted 145
11 SASI_Mm01_00094250 predicted 365
12 SASI_Mm01_00094251 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025421
VALIDATED
ACYP1 MISSION shRNA Bacterial Glycerol Stock
acylphosphatase 1, erythrocyte (common) type
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-390s1c1
Sequence:CCGGGTCATCGCAAACTTGGATTATCTCGAGATAATCCAAGTTTGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-403s1c1
Sequence:CCGGTGGATTATTCAGACTTCCAAACTCGAGTTTGGAAGTCTGAATAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-369s1c1
Sequence:CCGGGCAAACTTCAACAATGAGAAACTCGAGTTTCTCATTGTTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-203s1c1
Sequence:CCGGCCGCAAGTACACTCAGGCTGACTCGAGTCAGCCTGAGTGTACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025421.2-390s21c1
Sequence:CCGGGTCATCGCAAACTTGGATTATCTCGAGATAATCCAAGTTTGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025421.2-369s21c1
Sequence:CCGGGCAAACTTCAACAATGAGAAACTCGAGTTTCTCATTGTTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025421.2-343s21c1
Sequence:CCGGGAAGTCCCAAGTCGCACATTGCTCGAGCAATGTGCGACTTGGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025421.2-507s21c1
Sequence:CCGGGAACTATTCTGTGCTCAGTATCTCGAGATACTGAGCACAGAATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025421
VALIDATED
ACYP1 MISSION shRNA shRNA Plasmid DNA
acylphosphatase 1, erythrocyte (common) type
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-390s1c1
Sequence:CCGGGTCATCGCAAACTTGGATTATCTCGAGATAATCCAAGTTTGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-403s1c1
Sequence:CCGGTGGATTATTCAGACTTCCAAACTCGAGTTTGGAAGTCTGAATAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-369s1c1
Sequence:CCGGGCAAACTTCAACAATGAGAAACTCGAGTTTCTCATTGTTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-203s1c1
Sequence:CCGGCCGCAAGTACACTCAGGCTGACTCGAGTCAGCCTGAGTGTACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025421.2-390s21c1
Sequence:CCGGGTCATCGCAAACTTGGATTATCTCGAGATAATCCAAGTTTGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025421.2-369s21c1
Sequence:CCGGGCAAACTTCAACAATGAGAAACTCGAGTTTCTCATTGTTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025421.2-343s21c1
Sequence:CCGGGAAGTCCCAAGTCGCACATTGCTCGAGCAATGTGCGACTTGGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025421.2-507s21c1
Sequence:CCGGGAACTATTCTGTGCTCAGTATCTCGAGATACTGAGCACAGAATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025421
VALIDATED
ACYP1 MISSION shRNA Lentiviral Transduction Particles
acylphosphatase 1, erythrocyte (common) type
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-390s1c1
Sequence:CCGGGTCATCGCAAACTTGGATTATCTCGAGATAATCCAAGTTTGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-403s1c1
Sequence:CCGGTGGATTATTCAGACTTCCAAACTCGAGTTTGGAAGTCTGAATAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-369s1c1
Sequence:CCGGGCAAACTTCAACAATGAGAAACTCGAGTTTCTCATTGTTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025421.1-203s1c1
Sequence:CCGGCCGCAAGTACACTCAGGCTGACTCGAGTCAGCCTGAGTGTACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025421.2-390s21c1
Sequence:CCGGGTCATCGCAAACTTGGATTATCTCGAGATAATCCAAGTTTGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025421.2-369s21c1
Sequence:CCGGGCAAACTTCAACAATGAGAAACTCGAGTTTCTCATTGTTGAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025421.2-343s21c1
Sequence:CCGGGAAGTCCCAAGTCGCACATTGCTCGAGCAATGTGCGACTTGGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025421.2-507s21c1
Sequence:CCGGGAACTATTCTGTGCTCAGTATCTCGAGATACTGAGCACAGAATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001107
VALIDATED
ACYP1 MISSION shRNA Bacterial Glycerol Stock
acylphosphatase 1, erythrocyte (common) type
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-302s1c1
Sequence:CCGGCCTAAATCACACATCGACAAACTCGAGTTTGTCGATGTGTGATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-343s1c1
Sequence:CCGGAGTCATCTTGAAGTTGGATTACTCGAGTAATCCAACTTCAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001107.3-316s1c1
Sequence:CCGGCGACAAAGCAAACTTCAACAACTCGAGTTGTTGAAGTTTGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-251s1c1
Sequence:CCGGCCCATCTCCAAGGTGCGTCATCTCGAGATGACGCACCTTGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-359s1c1
Sequence:CCGGGATTACTCAGACTTCCAAATTCTCGAGAATTTGGAAGTCTGAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-278s21c1
Sequence:CCGGGAATGGCTTGAAACAAGAGGACTCGAGTCCTCTTGTTTCAAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-164s21c1
Sequence:CCGGCATACTCAGGCTGAGGGTAAACTCGAGTTTACCCTCAGCCTGAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-413s21c1
Sequence:CCGGATAAACTCAGTGGTTTGGTTTCTCGAGAAACCAAACCACTGAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-223s21c1
Sequence:CCGGGGGCACAGTGCAAGGACAATTCTCGAGAATTGTCCTTGCACTGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-343s21c1
Sequence:CCGGAGTCATCTTGAAGTTGGATTACTCGAGTAATCCAACTTCAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001107.3-303s21c1
Sequence:CCGGCTAAATCACACATCGACAAAGCTCGAGCTTTGTCGATGTGTGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-253s21c1
Sequence:CCGGCATCTCCAAGGTGCGTCATATCTCGAGATATGACGCACCTTGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-446s21c1
Sequence:CCGGGAGATAGAACTATTGTGTGTTCTCGAGAACACACAATAGTTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001107
VALIDATED
ACYP1 MISSION shRNA shRNA Plasmid DNA
acylphosphatase 1, erythrocyte (common) type
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-302s1c1
Sequence:CCGGCCTAAATCACACATCGACAAACTCGAGTTTGTCGATGTGTGATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-343s1c1
Sequence:CCGGAGTCATCTTGAAGTTGGATTACTCGAGTAATCCAACTTCAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001107.3-316s1c1
Sequence:CCGGCGACAAAGCAAACTTCAACAACTCGAGTTGTTGAAGTTTGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-251s1c1
Sequence:CCGGCCCATCTCCAAGGTGCGTCATCTCGAGATGACGCACCTTGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-359s1c1
Sequence:CCGGGATTACTCAGACTTCCAAATTCTCGAGAATTTGGAAGTCTGAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-278s21c1
Sequence:CCGGGAATGGCTTGAAACAAGAGGACTCGAGTCCTCTTGTTTCAAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-164s21c1
Sequence:CCGGCATACTCAGGCTGAGGGTAAACTCGAGTTTACCCTCAGCCTGAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-413s21c1
Sequence:CCGGATAAACTCAGTGGTTTGGTTTCTCGAGAAACCAAACCACTGAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-223s21c1
Sequence:CCGGGGGCACAGTGCAAGGACAATTCTCGAGAATTGTCCTTGCACTGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-343s21c1
Sequence:CCGGAGTCATCTTGAAGTTGGATTACTCGAGTAATCCAACTTCAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001107.3-303s21c1
Sequence:CCGGCTAAATCACACATCGACAAAGCTCGAGCTTTGTCGATGTGTGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-253s21c1
Sequence:CCGGCATCTCCAAGGTGCGTCATATCTCGAGATATGACGCACCTTGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-446s21c1
Sequence:CCGGGAGATAGAACTATTGTGTGTTCTCGAGAACACACAATAGTTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001107
VALIDATED
ACYP1 MISSION shRNA Lentiviral Transduction Particles
acylphosphatase 1, erythrocyte (common) type
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-302s1c1
Sequence:CCGGCCTAAATCACACATCGACAAACTCGAGTTTGTCGATGTGTGATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-343s1c1
Sequence:CCGGAGTCATCTTGAAGTTGGATTACTCGAGTAATCCAACTTCAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001107.3-316s1c1
Sequence:CCGGCGACAAAGCAAACTTCAACAACTCGAGTTGTTGAAGTTTGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-251s1c1
Sequence:CCGGCCCATCTCCAAGGTGCGTCATCTCGAGATGACGCACCTTGGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001107.3-359s1c1
Sequence:CCGGGATTACTCAGACTTCCAAATTCTCGAGAATTTGGAAGTCTGAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-278s21c1
Sequence:CCGGGAATGGCTTGAAACAAGAGGACTCGAGTCCTCTTGTTTCAAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-164s21c1
Sequence:CCGGCATACTCAGGCTGAGGGTAAACTCGAGTTTACCCTCAGCCTGAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-413s21c1
Sequence:CCGGATAAACTCAGTGGTTTGGTTTCTCGAGAAACCAAACCACTGAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-223s21c1
Sequence:CCGGGGGCACAGTGCAAGGACAATTCTCGAGAATTGTCCTTGCACTGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-343s21c1
Sequence:CCGGAGTCATCTTGAAGTTGGATTACTCGAGTAATCCAACTTCAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001107.3-303s21c1
Sequence:CCGGCTAAATCACACATCGACAAAGCTCGAGCTTTGTCGATGTGTGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-253s21c1
Sequence:CCGGCATCTCCAAGGTGCGTCATATCTCGAGATATGACGCACCTTGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001107.3-446s21c1
Sequence:CCGGGAGATAGAACTATTGTGTGTTCTCGAGAACACACAATAGTTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks