EMAIL THIS PAGE TO A FRIEND

ADA

adenosine deaminase

63 Gene Product Result for
UniProtKB ID: P00813, Q53F92, Q6LA59
Gene ID:
Human(100) Summary: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia. [provided by RefSeq, Jul 2008]
Mouse(11486) adenosine deaminase
Rat(24165) adenosine deaminase
Zebrafish(436919) adenosine deaminase
chicken(419194) adenosine deaminase
domestic cat(101090683) adenosine deaminase
cow(280712) adenosine deaminase
Horse(100070773) adenosine deaminase
dog(477236) adenosine deaminase
fruit fly(41092) Adenosine deaminase
naked mole-rat(101707051) adenosine deaminase
domestic guinea pig(100720869) adenosine deaminase
sheep(101106352) adenosine deaminase
Domestic Rabbit(100346236) adenosine deaminase
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A9251 Adenosine ≥99% human, rat pricing
A4036 Adenosine suitable for cell culture, BioReagent human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000022 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000022 Rosetta Predictions human pricing
NM_130399 Rosetta Predictions rat pricing
NM_007398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017424 predicted 980
2 SASI_Hs01_00017425 predicted 703
3 SASI_Hs01_00017426 predicted 954
4 SASI_Hs01_00017427 predicted 1144
5 SASI_Hs01_00017428 predicted 1029
6 SASI_Hs01_00017430 predicted 392
7 SASI_Hs01_00017431 predicted 850
8 SASI_Hs01_00017433 predicted 1116
9 SASI_Hs02_00301684 predicted 365
10 SASI_Hs02_00301685 predicted 853
11 SASI_Hs01_00017429 predicted 1241
12 SASI_Hs01_00017432 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031183 predicted 306
2 SASI_Rn01_00031184 predicted 1104
3 SASI_Rn01_00031185 predicted 809
4 SASI_Rn01_00031186 predicted 311
5 SASI_Rn01_00031187 predicted 198
6 SASI_Rn01_00031190 predicted 490
7 SASI_Rn02_00267375 predicted 347
8 SASI_Rn01_00031191 predicted 452
9 SASI_Rn01_00031192 predicted 902
10 SASI_Rn02_00267376 predicted 562
11 SASI_Rn01_00031188 predicted 220
12 SASI_Rn01_00031189 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136502 predicted 310
2 SASI_Mm01_00136503 predicted 510
3 SASI_Mm01_00136504 predicted 823
4 SASI_Mm01_00136505 predicted 1001
5 SASI_Mm01_00136506 predicted 355
6 SASI_Mm01_00136507 predicted 946
7 SASI_Mm01_00136508 predicted 675
8 SASI_Mm01_00136509 predicted 1008
9 SASI_Mm01_00136510 predicted 1122
10 SASI_Mm02_00311508 predicted 283
11 SASI_Mm01_00136511 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000022
VALIDATED
ADA MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-1133s1c1
Sequence:CCGGGCTCTATAAAGCCTATGGGATCTCGAGATCCCATAGGCTTTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000022.1-1068s1c1
Sequence:CCGGCTGAACATCAATGCGGCCAAACTCGAGTTTGGCCGCATTGATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_000022.1-927s1c1
Sequence:CCGGCATGCAGTCATTCGGCTCAAACTCGAGTTTGAGCCGAATGACTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-290s1c1
Sequence:CCGGTGACTACTACATGCCTGCTATCTCGAGATAGCAGGCATGTAGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-596s1c1
Sequence:CCGGGCTGTGTAAGAACTACCAGCACTCGAGTGCTGGTAGTTCTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-177s21c1
Sequence:CCGGCACCTAGACGGATCCATCAAGCTCGAGCTTGATGGATCCGTCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-200s21c1
Sequence:CCGGTGAAACCATCTTATACTATGGCTCGAGCCATAGTATAAGATGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000022.2-1343s21c1
Sequence:CCGGTGAACCCTATGTGTCCATTTCCTCGAGGAAATGGACACATAGGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-370s21c1
Sequence:CCGGGGATCGCCTATGAGTTTGTAGCTCGAGCTACAAACTCATAGGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000022.2-1305s21c1
Sequence:CCGGAGAAGACCATGATCTCAATAGCTCGAGCTATTGAGATCATGGTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-988s21c1
Sequence:CCGGAGGCTAACTACTCGCTCAACACTCGAGTGTTGAGCGAGTAGTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000022
VALIDATED
ADA MISSION shRNA shRNA Plasmid DNA
adenosine deaminase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-1133s1c1
Sequence:CCGGGCTCTATAAAGCCTATGGGATCTCGAGATCCCATAGGCTTTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000022.1-1068s1c1
Sequence:CCGGCTGAACATCAATGCGGCCAAACTCGAGTTTGGCCGCATTGATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_000022.1-927s1c1
Sequence:CCGGCATGCAGTCATTCGGCTCAAACTCGAGTTTGAGCCGAATGACTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-290s1c1
Sequence:CCGGTGACTACTACATGCCTGCTATCTCGAGATAGCAGGCATGTAGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-596s1c1
Sequence:CCGGGCTGTGTAAGAACTACCAGCACTCGAGTGCTGGTAGTTCTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-177s21c1
Sequence:CCGGCACCTAGACGGATCCATCAAGCTCGAGCTTGATGGATCCGTCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-200s21c1
Sequence:CCGGTGAAACCATCTTATACTATGGCTCGAGCCATAGTATAAGATGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000022.2-1343s21c1
Sequence:CCGGTGAACCCTATGTGTCCATTTCCTCGAGGAAATGGACACATAGGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-370s21c1
Sequence:CCGGGGATCGCCTATGAGTTTGTAGCTCGAGCTACAAACTCATAGGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000022.2-1305s21c1
Sequence:CCGGAGAAGACCATGATCTCAATAGCTCGAGCTATTGAGATCATGGTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-988s21c1
Sequence:CCGGAGGCTAACTACTCGCTCAACACTCGAGTGTTGAGCGAGTAGTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000022
VALIDATED
ADA MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-1133s1c1
Sequence:CCGGGCTCTATAAAGCCTATGGGATCTCGAGATCCCATAGGCTTTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000022.1-1068s1c1
Sequence:CCGGCTGAACATCAATGCGGCCAAACTCGAGTTTGGCCGCATTGATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_000022.1-927s1c1
Sequence:CCGGCATGCAGTCATTCGGCTCAAACTCGAGTTTGAGCCGAATGACTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-290s1c1
Sequence:CCGGTGACTACTACATGCCTGCTATCTCGAGATAGCAGGCATGTAGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000022.1-596s1c1
Sequence:CCGGGCTGTGTAAGAACTACCAGCACTCGAGTGCTGGTAGTTCTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-177s21c1
Sequence:CCGGCACCTAGACGGATCCATCAAGCTCGAGCTTGATGGATCCGTCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-200s21c1
Sequence:CCGGTGAAACCATCTTATACTATGGCTCGAGCCATAGTATAAGATGGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000022.2-1343s21c1
Sequence:CCGGTGAACCCTATGTGTCCATTTCCTCGAGGAAATGGACACATAGGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-370s21c1
Sequence:CCGGGGATCGCCTATGAGTTTGTAGCTCGAGCTACAAACTCATAGGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000022.2-1305s21c1
Sequence:CCGGAGAAGACCATGATCTCAATAGCTCGAGCTATTGAGATCATGGTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000022.2-988s21c1
Sequence:CCGGAGGCTAACTACTCGCTCAACACTCGAGTGTTGAGCGAGTAGTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007398
VALIDATED
ADA MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007398.2-1432s1c1
Sequence:CCGGGCTGGCTAGGATGCTAAGAAACTCGAGTTTCTTAGCATCCTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-283s1c1
Sequence:CCGGGACTACTACATGCCTGTGATTCTCGAGAATCACAGGCATGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-816s1c1
Sequence:CCGGCGAGGATGAAGCTCTCTACAACTCGAGTTGTAGAGAGCTTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-153s1c1
Sequence:CCGGCAAGCCAGAAACCATCTTATACTCGAGTATAAGATGGTTTCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-922s1c1
Sequence:CCGGGCGGTTGTTCGCTTCAAGAATCTCGAGATTCTTGAAGCGAACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-815s21c1
Sequence:CCGGCGAGGATGAAGCTCTCTACAACTCGAGTTGTAGAGAGCTTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-1198s21c1
Sequence:CCGGAGCCTCATCCTGTGGATAAAGCTCGAGCTTTATCCACAGGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-683s21c1
Sequence:CCGGAGCCTATGAGGGCGCAGTAAACTCGAGTTTACTGCGCCCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-152s21c1
Sequence:CCGGCAAGCCAGAAACCATCTTATACTCGAGTATAAGATGGTTTCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-921s21c1
Sequence:CCGGGCGGTTGTTCGCTTCAAGAATCTCGAGATTCTTGAAGCGAACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007398
VALIDATED
ADA MISSION shRNA shRNA Plasmid DNA
adenosine deaminase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007398.2-1432s1c1
Sequence:CCGGGCTGGCTAGGATGCTAAGAAACTCGAGTTTCTTAGCATCCTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-283s1c1
Sequence:CCGGGACTACTACATGCCTGTGATTCTCGAGAATCACAGGCATGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-816s1c1
Sequence:CCGGCGAGGATGAAGCTCTCTACAACTCGAGTTGTAGAGAGCTTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-153s1c1
Sequence:CCGGCAAGCCAGAAACCATCTTATACTCGAGTATAAGATGGTTTCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-922s1c1
Sequence:CCGGGCGGTTGTTCGCTTCAAGAATCTCGAGATTCTTGAAGCGAACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-815s21c1
Sequence:CCGGCGAGGATGAAGCTCTCTACAACTCGAGTTGTAGAGAGCTTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-1198s21c1
Sequence:CCGGAGCCTCATCCTGTGGATAAAGCTCGAGCTTTATCCACAGGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-683s21c1
Sequence:CCGGAGCCTATGAGGGCGCAGTAAACTCGAGTTTACTGCGCCCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-152s21c1
Sequence:CCGGCAAGCCAGAAACCATCTTATACTCGAGTATAAGATGGTTTCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-921s21c1
Sequence:CCGGGCGGTTGTTCGCTTCAAGAATCTCGAGATTCTTGAAGCGAACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007398
VALIDATED
ADA MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007398.2-1432s1c1
Sequence:CCGGGCTGGCTAGGATGCTAAGAAACTCGAGTTTCTTAGCATCCTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-283s1c1
Sequence:CCGGGACTACTACATGCCTGTGATTCTCGAGAATCACAGGCATGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-816s1c1
Sequence:CCGGCGAGGATGAAGCTCTCTACAACTCGAGTTGTAGAGAGCTTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-153s1c1
Sequence:CCGGCAAGCCAGAAACCATCTTATACTCGAGTATAAGATGGTTTCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007398.2-922s1c1
Sequence:CCGGGCGGTTGTTCGCTTCAAGAATCTCGAGATTCTTGAAGCGAACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-815s21c1
Sequence:CCGGCGAGGATGAAGCTCTCTACAACTCGAGTTGTAGAGAGCTTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-1198s21c1
Sequence:CCGGAGCCTCATCCTGTGGATAAAGCTCGAGCTTTATCCACAGGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-683s21c1
Sequence:CCGGAGCCTATGAGGGCGCAGTAAACTCGAGTTTACTGCGCCCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-152s21c1
Sequence:CCGGCAAGCCAGAAACCATCTTATACTCGAGTATAAGATGGTTTCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007398.3-921s21c1
Sequence:CCGGGCGGTTGTTCGCTTCAAGAATCTCGAGATTCTTGAAGCGAACAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks