EMAIL THIS PAGE TO A FRIEND

ADAD1

adenosine deaminase domain containing 1 (testis-specific)

50 Gene Product Result for
Synonyms: Tenr
UniProtKB ID: Q96M93, A6NKN4, B7WPB0, D3DNX2, Q8IWG6, Q8NA06
Gene ID:
Mouse(21744) adenosine deaminase domain containing 1 (testis specific)
Rat(294979) adenosine deaminase domain containing 1 (testis specific)
Zebrafish(334353) adenosine deaminase domain containing 1 (testis-specific)
chicken(422669) adenosine deaminase domain containing 1 (testis-specific)
dog(100686382) adenosine deaminase domain containing 1 (testis-specific)
domestic cat(101090859) adenosine deaminase domain containing 1 (testis-specific)
cow(537320) adenosine deaminase domain containing 1 (testis-specific)
sheep(101104272) adenosine deaminase domain containing 1 (testis-specific)
Domestic Rabbit(100357155) adenosine deaminase domain containing 1 (testis-specific)
domestic guinea pig(100723677) adenosine deaminase domain containing 1 (testis-specific)
naked mole-rat(101719868) adenosine deaminase domain containing 1 (testis-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063001 MISSION® esiRNA esiRNA targeting mouse Adad1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139243 Rosetta Predictions human pricing
NM_001006977 Rosetta Predictions rat pricing
NM_009350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034905 predicted 1110
2 SASI_Hs01_00034906 predicted 1291
3 SASI_Hs01_00034907 predicted 921
4 SASI_Hs01_00034908 predicted 674
5 SASI_Hs01_00034909 predicted 1374
6 SASI_Hs01_00034910 predicted 1526
7 SASI_Hs01_00034911 predicted 768
8 SASI_Hs01_00034912 predicted 1533
9 SASI_Hs02_00364246 predicted 1011
10 SASI_Hs01_00034914 predicted 817
11 SASI_Hs01_00034913 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069493 predicted 1582
2 SASI_Rn01_00069494 predicted 1669
3 SASI_Rn01_00069495 predicted 1399
4 SASI_Rn01_00069496 predicted 1685
5 SASI_Rn01_00069498 predicted 1662
6 SASI_Rn01_00069499 predicted 785
7 SASI_Rn01_00069500 predicted 937
8 SASI_Rn02_00198543 predicted 1547
9 SASI_Rn01_00069502 predicted 1163
10 SASI_Rn02_00198544 predicted 1156
11 SASI_Rn01_00069497 predicted 1497
12 SASI_Rn01_00069501 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191152 predicted 1726
2 SASI_Mm01_00191153 predicted 841
3 SASI_Mm02_00315933 predicted 1147
4 SASI_Mm01_00191154 predicted 933
5 SASI_Mm02_00315934 predicted 197
6 SASI_Mm01_00191156 predicted 1583
7 SASI_Mm01_00191157 predicted 1599
8 SASI_Mm01_00191159 predicted 999
9 SASI_Mm01_00191160 predicted 285
10 SASI_Mm01_00191161 predicted 1210
11 SASI_Mm01_00191155 predicted 1711
12 SASI_Mm01_00191158 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139243
ADAD1 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase domain containing 1 (testis-specific)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-305s21c1
Sequence:CCGGCCAGTTCAACCAGCGACAAAGCTCGAGCTTTGTCGCTGGTTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-1508s21c1
Sequence:CCGGGGCTTAGAAATCGCTATAAAGCTCGAGCTTTATAGCGATTTCTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-1575s21c1
Sequence:CCGGTAGTCAACAGACCTCATATTACTCGAGTAATATGAGGTCTGTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-281s1c1
Sequence:CCGGCGATAACTACACCCACAGGATCTCGAGATCCTGTGGGTGTAGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-334s1c1
Sequence:CCGGGCATCCAAGGTTACGCAAGTACTCGAGTACTTGCGTAACCTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-1780s1c1
Sequence:CCGGGCTGGTACATATCATGCAGCTCTCGAGAGCTGCATGATATGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-1720s1c1
Sequence:CCGGGCTGCAATGTTAAGTCGGTTTCTCGAGAAACCGACTTAACATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-805s1c1
Sequence:CCGGGCAAAGATTTCACAGATCGTTCTCGAGAACGATCTGTGAAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139243
ADAD1 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase domain containing 1 (testis-specific)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-305s21c1
Sequence:CCGGCCAGTTCAACCAGCGACAAAGCTCGAGCTTTGTCGCTGGTTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-1508s21c1
Sequence:CCGGGGCTTAGAAATCGCTATAAAGCTCGAGCTTTATAGCGATTTCTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-1575s21c1
Sequence:CCGGTAGTCAACAGACCTCATATTACTCGAGTAATATGAGGTCTGTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-281s1c1
Sequence:CCGGCGATAACTACACCCACAGGATCTCGAGATCCTGTGGGTGTAGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-334s1c1
Sequence:CCGGGCATCCAAGGTTACGCAAGTACTCGAGTACTTGCGTAACCTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-1780s1c1
Sequence:CCGGGCTGGTACATATCATGCAGCTCTCGAGAGCTGCATGATATGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-1720s1c1
Sequence:CCGGGCTGCAATGTTAAGTCGGTTTCTCGAGAAACCGACTTAACATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-805s1c1
Sequence:CCGGGCAAAGATTTCACAGATCGTTCTCGAGAACGATCTGTGAAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139243
ADAD1 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase domain containing 1 (testis-specific)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-305s21c1
Sequence:CCGGCCAGTTCAACCAGCGACAAAGCTCGAGCTTTGTCGCTGGTTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-1508s21c1
Sequence:CCGGGGCTTAGAAATCGCTATAAAGCTCGAGCTTTATAGCGATTTCTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139243.3-1575s21c1
Sequence:CCGGTAGTCAACAGACCTCATATTACTCGAGTAATATGAGGTCTGTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-281s1c1
Sequence:CCGGCGATAACTACACCCACAGGATCTCGAGATCCTGTGGGTGTAGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-334s1c1
Sequence:CCGGGCATCCAAGGTTACGCAAGTACTCGAGTACTTGCGTAACCTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-1780s1c1
Sequence:CCGGGCTGGTACATATCATGCAGCTCTCGAGAGCTGCATGATATGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-1720s1c1
Sequence:CCGGGCTGCAATGTTAAGTCGGTTTCTCGAGAAACCGACTTAACATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139243.1-805s1c1
Sequence:CCGGGCAAAGATTTCACAGATCGTTCTCGAGAACGATCTGTGAAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009350
ADAD1 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase domain containing 1 (testis-specific)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1402s1c1
Sequence:CCGGGCCAGTTTATATCAGCAGTATCTCGAGATACTGCTGATATAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1570s1c1
Sequence:CCGGGCAGATAAACTTGGACCATAACTCGAGTTATGGTCCAAGTTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1715s1c1
Sequence:CCGGGCTGCAATGTTAAGTCGATTTCTCGAGAAATCGACTTAACATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1181s1c1
Sequence:CCGGGCCCAGATTAAGTCACAGTTACTCGAGTAACTGTGACTTAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1389s1c1
Sequence:CCGGGTCACTTTATACAGCCAGTTTCTCGAGAAACTGGCTGTATAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009350
ADAD1 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase domain containing 1 (testis-specific)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1402s1c1
Sequence:CCGGGCCAGTTTATATCAGCAGTATCTCGAGATACTGCTGATATAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1570s1c1
Sequence:CCGGGCAGATAAACTTGGACCATAACTCGAGTTATGGTCCAAGTTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1715s1c1
Sequence:CCGGGCTGCAATGTTAAGTCGATTTCTCGAGAAATCGACTTAACATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1181s1c1
Sequence:CCGGGCCCAGATTAAGTCACAGTTACTCGAGTAACTGTGACTTAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1389s1c1
Sequence:CCGGGTCACTTTATACAGCCAGTTTCTCGAGAAACTGGCTGTATAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009350
ADAD1 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase domain containing 1 (testis-specific)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1402s1c1
Sequence:CCGGGCCAGTTTATATCAGCAGTATCTCGAGATACTGCTGATATAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1570s1c1
Sequence:CCGGGCAGATAAACTTGGACCATAACTCGAGTTATGGTCCAAGTTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1715s1c1
Sequence:CCGGGCTGCAATGTTAAGTCGATTTCTCGAGAAATCGACTTAACATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1181s1c1
Sequence:CCGGGCCCAGATTAAGTCACAGTTACTCGAGTAACTGTGACTTAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009350.1-1389s1c1
Sequence:CCGGGTCACTTTATACAGCCAGTTTCTCGAGAAACTGGCTGTATAAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks