EMAIL THIS PAGE TO A FRIEND

ADAD2

adenosine deaminase domain containing 2

57 Gene Product Result for
Synonyms: TENRL
UniProtKB ID: Q8NCV1, B2RCL6, Q8NA94
Gene ID:
Mouse(75773) adenosine deaminase domain containing 2
Rat(691275) adenosine deaminase domain containing 2
cow(616079) adenosine deaminase domain containing 2
Horse(100070132) adenosine deaminase domain containing 2
dog(100685297) adenosine deaminase domain containing 2
domestic cat(101088382) adenosine deaminase domain containing 2
naked mole-rat(101713198) adenosine deaminase domain containing 2
domestic guinea pig(100729858) adenosine deaminase domain containing 2
sheep(101123319) adenosine deaminase domain containing 2
Domestic Rabbit(100344287) adenosine deaminase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139174 Rosetta Predictions human pricing
XM_001481313 Rosetta Predictions mouse pricing
XM_486166 Rosetta Predictions mouse pricing
XM_915766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141658 predicted 1948
2 SASI_Hs01_00141659 predicted 1327
3 SASI_Hs01_00141660 predicted 1892
4 SASI_Hs01_00141661 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423636 predicted 1199
2 SASI_Mm02_00423637 predicted 1584
3 SASI_Mm02_00423638 predicted 1303
4 SASI_Mm02_00423639 predicted 1285
5 SASI_Mm02_00423640 predicted 725
6 SASI_Mm02_00423641 predicted 1221
7 SASI_Mm02_00423642 predicted 1090
8 SASI_Mm02_00423643 predicted 479
9 SASI_Mm02_00423644 predicted 1266
10 SASI_Mm02_00423645 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220238 predicted 1113
2 SASI_Mm01_00220239 predicted 1113
3 SASI_Mm02_00426804 predicted 987
4 SASI_Mm01_00220241 predicted 1108
5 SASI_Mm02_00426805 predicted 1028
6 SASI_Mm02_00426806 predicted 408
7 SASI_Mm02_00426807 predicted 400
8 SASI_Mm02_00426808 predicted 1082
9 SASI_Mm02_00426809 predicted 1143
10 SASI_Mm01_00220232 predicted 1711
11 SASI_Mm01_00220233 predicted 1717
12 SASI_Mm01_00220234 predicted 1333
13 SASI_Mm01_00220235 predicted 1312
14 SASI_Mm01_00220236 predicted 1312
15 SASI_Mm01_00220237 predicted 1246
16 SASI_Mm01_00220240 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275828 predicted 1086
2 SASI_Mm01_00275829 predicted 1083
3 SASI_Mm02_00439729 predicted 956
4 SASI_Mm01_00275831 predicted 1079
5 SASI_Mm02_00439730 predicted 1004
6 SASI_Mm02_00439731 predicted 410
7 SASI_Mm02_00439732 predicted 400
8 SASI_Mm02_00439733 predicted 1067
9 SASI_Mm02_00439734 predicted 1123
10 SASI_Mm01_00275822 predicted 1685
11 SASI_Mm01_00275823 predicted 1688
12 SASI_Mm01_00275824 predicted 1311
13 SASI_Mm01_00275825 predicted 1287
14 SASI_Mm01_00275826 predicted 1291
15 SASI_Mm01_00275827 predicted 1228
16 SASI_Mm01_00275830 predicted 1278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139174
ADAD2 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-147s1c1
Sequence:CCGGCCTGGCTGCATCGTTGCAGATCTCGAGATCTGCAACGATGCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-990s1c1
Sequence:CCGGCTCGCCATACTGGGCCTGTAACTCGAGTTACAGGCCCAGTATGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-441s1c1
Sequence:CCGGCGTGTCCTTGCTCACGGAGTACTCGAGTACTCCGTGAGCAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-913s1c1
Sequence:CCGGGTAGAGAACATCCTGACCCATCTCGAGATGGGTCAGGATGTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-1888s1c1
Sequence:CCGGCGTCTCTGCAAGGCCTCCTTTCTCGAGAAAGGAGGCCTTGCAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-568s21c1
Sequence:CCGGGAATTGAAAGCAATGTGTCTGCTCGAGCAGACACATTGCTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-667s21c1
Sequence:CCGGCCTGACTCAAGTTGGGCAAACCTCGAGGTTTGCCCAACTTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-709s21c1
Sequence:CCGGTGTGAAATGGAGTCACGCATCCTCGAGGATGCGTGACTCCATTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139174
ADAD2 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-147s1c1
Sequence:CCGGCCTGGCTGCATCGTTGCAGATCTCGAGATCTGCAACGATGCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-990s1c1
Sequence:CCGGCTCGCCATACTGGGCCTGTAACTCGAGTTACAGGCCCAGTATGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-441s1c1
Sequence:CCGGCGTGTCCTTGCTCACGGAGTACTCGAGTACTCCGTGAGCAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-913s1c1
Sequence:CCGGGTAGAGAACATCCTGACCCATCTCGAGATGGGTCAGGATGTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-1888s1c1
Sequence:CCGGCGTCTCTGCAAGGCCTCCTTTCTCGAGAAAGGAGGCCTTGCAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-568s21c1
Sequence:CCGGGAATTGAAAGCAATGTGTCTGCTCGAGCAGACACATTGCTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-667s21c1
Sequence:CCGGCCTGACTCAAGTTGGGCAAACCTCGAGGTTTGCCCAACTTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-709s21c1
Sequence:CCGGTGTGAAATGGAGTCACGCATCCTCGAGGATGCGTGACTCCATTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139174
ADAD2 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-147s1c1
Sequence:CCGGCCTGGCTGCATCGTTGCAGATCTCGAGATCTGCAACGATGCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-990s1c1
Sequence:CCGGCTCGCCATACTGGGCCTGTAACTCGAGTTACAGGCCCAGTATGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-441s1c1
Sequence:CCGGCGTGTCCTTGCTCACGGAGTACTCGAGTACTCCGTGAGCAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-913s1c1
Sequence:CCGGGTAGAGAACATCCTGACCCATCTCGAGATGGGTCAGGATGTTCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139174.2-1888s1c1
Sequence:CCGGCGTCTCTGCAAGGCCTCCTTTCTCGAGAAAGGAGGCCTTGCAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-568s21c1
Sequence:CCGGGAATTGAAAGCAATGTGTCTGCTCGAGCAGACACATTGCTTTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-667s21c1
Sequence:CCGGCCTGACTCAAGTTGGGCAAACCTCGAGGTTTGCCCAACTTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139174.3-709s21c1
Sequence:CCGGTGTGAAATGGAGTCACGCATCCTCGAGGATGCGTGACTCCATTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029428
ADAD2 MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1087s21c1
Sequence:CCGGTGGACAGCTGAAGCCTGTATCCTCGAGGATACAGGCTTCAGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-721s21c1
Sequence:CCGGCCACTCCAAAGAGACCTATGACTCGAGTCATAGGTCTCTTTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1689s21c1
Sequence:CCGGCAAAGCCATTGGTGGGTAAATCTCGAGATTTACCCACCAATGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029428.1-1755s21c1
Sequence:CCGGTGAACCTCAACAGCGGAAGAACTCGAGTTCTTCCGCTGTTGAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1272s21c1
Sequence:CCGGCAACTCTGAACCGGGTCATTCCTCGAGGAATGACCCGGTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029428
ADAD2 MISSION shRNA shRNA Plasmid DNA
adenosine deaminase domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1087s21c1
Sequence:CCGGTGGACAGCTGAAGCCTGTATCCTCGAGGATACAGGCTTCAGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-721s21c1
Sequence:CCGGCCACTCCAAAGAGACCTATGACTCGAGTCATAGGTCTCTTTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1689s21c1
Sequence:CCGGCAAAGCCATTGGTGGGTAAATCTCGAGATTTACCCACCAATGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029428.1-1755s21c1
Sequence:CCGGTGAACCTCAACAGCGGAAGAACTCGAGTTCTTCCGCTGTTGAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1272s21c1
Sequence:CCGGCAACTCTGAACCGGGTCATTCCTCGAGGAATGACCCGGTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029428
ADAD2 MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1087s21c1
Sequence:CCGGTGGACAGCTGAAGCCTGTATCCTCGAGGATACAGGCTTCAGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-721s21c1
Sequence:CCGGCCACTCCAAAGAGACCTATGACTCGAGTCATAGGTCTCTTTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1689s21c1
Sequence:CCGGCAAAGCCATTGGTGGGTAAATCTCGAGATTTACCCACCAATGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029428.1-1755s21c1
Sequence:CCGGTGAACCTCAACAGCGGAAGAACTCGAGTTCTTCCGCTGTTGAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029428.1-1272s21c1
Sequence:CCGGCAACTCTGAACCGGGTCATTCCTCGAGGAATGACCCGGTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks