EMAIL THIS PAGE TO A FRIEND

ADAL

adenosine deaminase-like

UniProtKB ID: Q6DHV7, A6NHZ3, B4DQM8
Gene ID:
Mouse(75894) adenosine deaminase-like
Rat(311352) adenosine deaminase-like
sheep(101106885) adenosine deaminase-like
domestic guinea pig(100724593) adenosine deaminase-like
naked mole-rat(101717260) adenosine deaminase-like
Zebrafish(619263) adenosine deaminase-like
cow(512667) adenosine deaminase-like
Horse(100070813) adenosine deaminase-like
domestic cat(101099639) adenosine deaminase-like
dog(487525) adenosine deaminase-like
chicken(415391) adenosine deaminase-like
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012969 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083991 MISSION® esiRNA esiRNA human ADAL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012969 Rosetta Predictions human pricing
NM_001014047 Rosetta Predictions rat pricing
XM_001076459 Rosetta Predictions rat pricing
XM_001076480 Rosetta Predictions rat pricing
NM_029475 Rosetta Predictions mouse pricing
XM_485055 Rosetta Predictions mouse pricing
XM_900839 Rosetta Predictions mouse pricing
XM_900849 Rosetta Predictions mouse pricing
XM_900856 Rosetta Predictions mouse pricing
XM_900859 Rosetta Predictions mouse pricing
XM_900862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160513 predicted 699
2 SASI_Hs01_00160514 predicted 780
3 SASI_Hs02_00306269 predicted 541
4 SASI_Hs01_00160515 predicted 822
5 SASI_Hs01_00160516 predicted 628
6 SASI_Hs01_00160517 predicted 496
7 SASI_Hs01_00160518 predicted 655
8 SASI_Hs01_00160519 predicted 484
9 SASI_Hs01_00160520 predicted 560
10 SASI_Hs01_00160521 predicted 769
11 SASI_Hs01_00160522 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201439 predicted 246
2 SASI_Rn01_00118264 predicted 586
3 SASI_Rn01_00118265 predicted 626
4 SASI_Rn01_00118266 predicted 377
5 SASI_Rn01_00118267 predicted 787
6 SASI_Rn01_00118268 predicted 544
7 SASI_Rn01_00118269 predicted 349
8 SASI_Rn01_00118270 predicted 403
9 SASI_Rn01_00118271 predicted 903
10 SASI_Rn01_00118272 predicted 204
11 SASI_Rn01_00118273 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353302 predicted 411
2 SASI_Rn02_00353303 predicted 815
3 SASI_Rn02_00353304 predicted 542
4 SASI_Rn02_00353305 predicted 978
5 SASI_Rn02_00353306 predicted 743
6 SASI_Rn02_00353307 predicted 521
7 SASI_Rn02_00353308 predicted 571
8 SASI_Rn02_00353309 predicted 1096
9 SASI_Rn02_00353310 predicted 370
10 SASI_Rn02_00353311 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353392 predicted 1039
2 SASI_Rn02_00353393 predicted 769
3 SASI_Rn02_00353394 predicted 1192
4 SASI_Rn02_00353395 predicted 391
5 SASI_Rn02_00353396 predicted 962
6 SASI_Rn02_00353397 predicted 734
7 SASI_Rn02_00353398 predicted 789
8 SASI_Rn02_00353399 predicted 1319
9 SASI_Rn02_00353400 predicted 582
10 SASI_Rn02_00353401 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335403 predicted 305
2 SASI_Mm02_00335404 predicted 1247
3 SASI_Mm02_00335405 predicted 1161
4 SASI_Mm02_00335406 predicted 375
5 SASI_Mm02_00335407 predicted 242
6 SASI_Mm02_00335408 predicted 728
7 SASI_Mm02_00335409 predicted 988
8 SASI_Mm02_00335410 predicted 1242
9 SASI_Mm02_00335411 predicted 502
10 SASI_Mm02_00335412 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205832 predicted 640
2 SASI_Mm01_00205833 predicted 1588
3 SASI_Mm01_00205834 predicted 1488
4 SASI_Mm01_00205835 predicted 713
5 SASI_Mm01_00205836 predicted 574
6 SASI_Mm01_00205837 predicted 1321
7 SASI_Mm01_00205838 predicted 978
8 SASI_Mm01_00205839 predicted 1570
9 SASI_Mm01_00205840 predicted 837
10 SASI_Mm01_00205841 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279138 predicted 1444
2 SASI_Mm01_00279139 predicted 1443
3 SASI_Mm01_00279140 predicted 1353
4 SASI_Mm01_00279141 predicted 1102
5 SASI_Mm01_00279142 predicted 915
6 SASI_Mm01_00279143 predicted 1327
7 SASI_Mm01_00279144 predicted 1179
8 SASI_Mm01_00279145 predicted 1431
9 SASI_Mm01_00279146 predicted 1192
10 SASI_Mm01_00279147 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215600 predicted 609
2 SASI_Mm01_00215601 predicted 565
3 SASI_Mm01_00215602 predicted 580
4 SASI_Mm01_00215603 predicted 595
5 SASI_Mm01_00215604 predicted 563
6 SASI_Mm01_00215605 predicted 605
7 SASI_Mm01_00215606 predicted 555
8 SASI_Mm01_00215607 predicted 558
9 SASI_Mm01_00215608 predicted 556
10 SASI_Mm01_00215609 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253790 predicted 1818
2 SASI_Mm01_00253791 predicted 1407
3 SASI_Mm01_00253792 predicted 1358
4 SASI_Mm01_00253793 predicted 1310
5 SASI_Mm01_00253794 predicted 1686
6 SASI_Mm01_00253795 predicted 1552
7 SASI_Mm01_00253796 predicted 1557
8 SASI_Mm01_00253797 predicted 1507
9 SASI_Mm01_00253798 predicted 1389
10 SASI_Mm01_00253799 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284626 predicted 804
2 SASI_Mm01_00284627 predicted 800
3 SASI_Mm01_00284628 predicted 714
4 SASI_Mm01_00284629 predicted 455
5 SASI_Mm01_00284630 predicted 277
6 SASI_Mm01_00284631 predicted 684
7 SASI_Mm01_00284632 predicted 542
8 SASI_Mm01_00284633 predicted 789
9 SASI_Mm01_00284634 predicted 545
10 SASI_Mm01_00284635 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253861 predicted 1514
2 SASI_Mm01_00253862 predicted 1516
3 SASI_Mm01_00253863 predicted 1414
4 SASI_Mm01_00253864 predicted 985
5 SASI_Mm01_00253865 predicted 1251
6 SASI_Mm01_00253866 predicted 895
7 SASI_Mm01_00253867 predicted 1502
8 SASI_Mm01_00253868 predicted 764
9 SASI_Mm01_00253869 predicted 779
10 SASI_Mm01_00253870 predicted 1489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029475
VALIDATED
ADAL MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029475.1-635s21c1
Sequence:CCGGCTCAGTGGAGATCCAACTATACTCGAGTATAGTTGGATCTCCACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-299s21c1
Sequence:CCGGTTCCAGATGTTCCAAGTTATACTCGAGTATAACTTGGAACATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-512s21c1
Sequence:CCGGGATATTGATGTTAGGTATTTGCTCGAGCAAATACCTAACATCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-1897s21c1
Sequence:CCGGAGCCTACAGGTATAGACTTATCTCGAGATAAGTCTATACCTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029475.1-915s21c1
Sequence:CCGGCTTATGATCAGCATCACTTTGCTCGAGCAAAGTGATGCTGATCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029475
VALIDATED
ADAL MISSION shRNA shRNA Plasmid DNA
adenosine deaminase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029475.1-635s21c1
Sequence:CCGGCTCAGTGGAGATCCAACTATACTCGAGTATAGTTGGATCTCCACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-299s21c1
Sequence:CCGGTTCCAGATGTTCCAAGTTATACTCGAGTATAACTTGGAACATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-512s21c1
Sequence:CCGGGATATTGATGTTAGGTATTTGCTCGAGCAAATACCTAACATCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-1897s21c1
Sequence:CCGGAGCCTACAGGTATAGACTTATCTCGAGATAAGTCTATACCTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029475.1-915s21c1
Sequence:CCGGCTTATGATCAGCATCACTTTGCTCGAGCAAAGTGATGCTGATCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029475
VALIDATED
ADAL MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029475.1-635s21c1
Sequence:CCGGCTCAGTGGAGATCCAACTATACTCGAGTATAGTTGGATCTCCACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-299s21c1
Sequence:CCGGTTCCAGATGTTCCAAGTTATACTCGAGTATAACTTGGAACATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-512s21c1
Sequence:CCGGGATATTGATGTTAGGTATTTGCTCGAGCAAATACCTAACATCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029475.1-1897s21c1
Sequence:CCGGAGCCTACAGGTATAGACTTATCTCGAGATAAGTCTATACCTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029475.1-915s21c1
Sequence:CCGGCTTATGATCAGCATCACTTTGCTCGAGCAAAGTGATGCTGATCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012969
ADAL MISSION shRNA Bacterial Glycerol Stock
adenosine deaminase-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-1110s1c1
Sequence:CCGGCGGGCATGGAACATTTCTCAACTCGAGTTGAGAAATGTTCCATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-1072s1c1
Sequence:CCGGGAAACACAAATACTCCTGGATCTCGAGATCCAGGAGTATTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-621s1c1
Sequence:CCGGCCAGATGTTTCAAACTATTCACTCGAGTGAATAGTTTGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-1036s1c1
Sequence:CCGGGCATTGCATCTTTCAGAGATTCTCGAGAATCTCTGAAAGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012969.1-1353s1c1
Sequence:CCGGGCTTTAGCTTCCATTAGAATACTCGAGTATTCTAATGGAAGCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012969.1-1425s1c1
Sequence:CCGGCCAATGCTTGGAACTCAATAACTCGAGTTATTGAGTTCCAAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-1078s1c1
Sequence:CCGGCAAATACTCCTGGATCTGCTTCTCGAGAAGCAGATCCAGGAGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-713s1c1
Sequence:CCGGGCGTCAAGTACCTGGAACTAACTCGAGTTAGTTCCAGGTACTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012969
ADAL MISSION shRNA shRNA Plasmid DNA
adenosine deaminase-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-1110s1c1
Sequence:CCGGCGGGCATGGAACATTTCTCAACTCGAGTTGAGAAATGTTCCATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-1072s1c1
Sequence:CCGGGAAACACAAATACTCCTGGATCTCGAGATCCAGGAGTATTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-621s1c1
Sequence:CCGGCCAGATGTTTCAAACTATTCACTCGAGTGAATAGTTTGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-1036s1c1
Sequence:CCGGGCATTGCATCTTTCAGAGATTCTCGAGAATCTCTGAAAGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012969.1-1353s1c1
Sequence:CCGGGCTTTAGCTTCCATTAGAATACTCGAGTATTCTAATGGAAGCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012969.1-1425s1c1
Sequence:CCGGCCAATGCTTGGAACTCAATAACTCGAGTTATTGAGTTCCAAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-1078s1c1
Sequence:CCGGCAAATACTCCTGGATCTGCTTCTCGAGAAGCAGATCCAGGAGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-713s1c1
Sequence:CCGGGCGTCAAGTACCTGGAACTAACTCGAGTTAGTTCCAGGTACTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012969
ADAL MISSION shRNA Lentiviral Transduction Particles
adenosine deaminase-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-1110s1c1
Sequence:CCGGCGGGCATGGAACATTTCTCAACTCGAGTTGAGAAATGTTCCATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-1072s1c1
Sequence:CCGGGAAACACAAATACTCCTGGATCTCGAGATCCAGGAGTATTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-621s1c1
Sequence:CCGGCCAGATGTTTCAAACTATTCACTCGAGTGAATAGTTTGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012969.1-1036s1c1
Sequence:CCGGGCATTGCATCTTTCAGAGATTCTCGAGAATCTCTGAAAGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012969.1-1353s1c1
Sequence:CCGGGCTTTAGCTTCCATTAGAATACTCGAGTATTCTAATGGAAGCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012969.1-1425s1c1
Sequence:CCGGCCAATGCTTGGAACTCAATAACTCGAGTTATTGAGTTCCAAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-1078s1c1
Sequence:CCGGCAAATACTCCTGGATCTGCTTCTCGAGAAGCAGATCCAGGAGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012969.1-713s1c1
Sequence:CCGGGCGTCAAGTACCTGGAACTAACTCGAGTTAGTTCCAGGTACTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks