EMAIL THIS PAGE TO A FRIEND

ADAM10

ADAM metallopeptidase domain 10

171 Gene Product Result for
Synonyms: AD10 CD156c HsT18717 MADM kuz
UniProtKB ID: O14672, Q10742, Q92650
Gene ID:
Human(102) Summary: Members of the ADAM family are cell surface proteins with a unique structure possessing both potential adhesion and protease domains. This gene encodes and ADAM family member that cleaves many proteins including TNF-alpha and E-cadherin. [provided by RefSeq, Jul 2008]
Mouse(11487) a disintegrin and metallopeptidase domain 10
Rat(29650) ADAM metallopeptidase domain 10
chicken(374113) ADAM metallopeptidase domain 10
domestic cat(101087998) ADAM metallopeptidase domain 10
cow(282132) ADAM metallopeptidase domain 10
Horse(100068314) ADAM metallopeptidase domain 10
dog(478321) ADAM metallopeptidase domain 10
naked mole-rat(101698280) ADAM metallopeptidase domain 10
domestic guinea pig(100718999) ADAM metallopeptidase domain 10
sheep(101116733) ADAM metallopeptidase domain 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129311 MISSION® esiRNA esiRNA human ADAM10 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
AG533 ADAM 10, control peptide for AB19026 50 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110 siRNAs that have been validated in the lab human pricing
XM_001054737 Rosetta Predictions rat pricing
XM_217197 Rosetta Predictions rat pricing
NM_007399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028097 validated 1266
1 SASI_Hs01_00028098 validated 1178
1 SASI_Hs01_00028096 validated 1533
2 SASI_Hs02_00324843 predicted 2779
3 SASI_Hs02_00324844 predicted 1514
4 SASI_Hs01_00028099 predicted 2462
5 SASI_Hs01_00028100 predicted 2536
6 SASI_Hs01_00028102 predicted 1584
7 SASI_Hs01_00028103 predicted 1858
8 SASI_Hs01_00028104 predicted 1362
9 SASI_Hs01_00028105 predicted 1497
10 SASI_Hs01_00028101 predicted 1949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276989 predicted 2269
2 SASI_Rn02_00276990 predicted 1024
3 SASI_Rn02_00276991 predicted 1418
4 SASI_Rn02_00276992 predicted 1982
5 SASI_Rn02_00276993 predicted 1061
6 SASI_Rn02_00276994 predicted 288
7 SASI_Rn02_00276995 predicted 2260
8 SASI_Rn02_00276996 predicted 2055
9 SASI_Rn02_00276997 predicted 405
10 SASI_Rn02_00276998 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377050 predicted 1439
2 SASI_Rn02_00377051 predicted 1662
3 SASI_Rn02_00377052 predicted 1635
4 SASI_Rn02_00377053 predicted 1524
5 SASI_Rn02_00377054 predicted 1465
6 SASI_Rn02_00377055 predicted 1417
7 SASI_Rn02_00377056 predicted 1643
8 SASI_Rn02_00377057 predicted 1542
9 SASI_Rn02_00377058 predicted 1484
10 SASI_Rn02_00377059 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197171 predicted 619
2 SASI_Mm01_00197172 predicted 1414
3 SASI_Mm01_00197173 predicted 404
4 SASI_Mm02_00311509 predicted 2539
5 SASI_Mm02_00311510 predicted 287
6 SASI_Mm01_00197176 predicted 1057
7 SASI_Mm01_00197177 predicted 934
8 SASI_Mm02_00311511 predicted 353
9 SASI_Mm01_00197179 predicted 1871
10 SASI_Mm02_00311512 predicted 1896
11 SASI_Mm01_00197170 predicted 290
12 SASI_Mm01_00197174 predicted 1579
13 SASI_Mm01_00197175 predicted 1193
14 SASI_Mm01_00197178 predicted 1927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110
VALIDATED
ADAM10 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-2859s1c1
Sequence:CCGGCCAGGTGGAATTACTTAAATTCTCGAGAATTTAAGTAATTCCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-2171s1c1
Sequence:CCGGGCAGGTTCTATCTGTGAGAAACTCGAGTTTCTCACAGATAGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-1324s1c1
Sequence:CCGGCCCTACAAATCCTTTCCGTTTCTCGAGAAACGGAAAGGATTTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001110.1-2507s1c1
Sequence:CCGGGCAGTATTACTTATGGGAATTCTCGAGAATTCCCATAAGTAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-984s1c1
Sequence:CCGGGCTGTGCAGATCATTCAGTATCTCGAGATACTGAATGATCTGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110.2-1802s21c1
Sequence:CCGGTTGAATCTGGCCAACCTATTTCTCGAGAAATAGGTTGGCCAGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110.2-2545s21c1
Sequence:CCGGGTTCATACTCCAAGTAGTAATCTCGAGATTACTACTTGGAGTATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110
VALIDATED
ADAM10 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-2859s1c1
Sequence:CCGGCCAGGTGGAATTACTTAAATTCTCGAGAATTTAAGTAATTCCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-2171s1c1
Sequence:CCGGGCAGGTTCTATCTGTGAGAAACTCGAGTTTCTCACAGATAGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-1324s1c1
Sequence:CCGGCCCTACAAATCCTTTCCGTTTCTCGAGAAACGGAAAGGATTTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001110.1-2507s1c1
Sequence:CCGGGCAGTATTACTTATGGGAATTCTCGAGAATTCCCATAAGTAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-984s1c1
Sequence:CCGGGCTGTGCAGATCATTCAGTATCTCGAGATACTGAATGATCTGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110.2-1802s21c1
Sequence:CCGGTTGAATCTGGCCAACCTATTTCTCGAGAAATAGGTTGGCCAGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110.2-2545s21c1
Sequence:CCGGGTTCATACTCCAAGTAGTAATCTCGAGATTACTACTTGGAGTATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110
VALIDATED
ADAM10 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-2859s1c1
Sequence:CCGGCCAGGTGGAATTACTTAAATTCTCGAGAATTTAAGTAATTCCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-2171s1c1
Sequence:CCGGGCAGGTTCTATCTGTGAGAAACTCGAGTTTCTCACAGATAGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-1324s1c1
Sequence:CCGGCCCTACAAATCCTTTCCGTTTCTCGAGAAACGGAAAGGATTTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001110.1-2507s1c1
Sequence:CCGGGCAGTATTACTTATGGGAATTCTCGAGAATTCCCATAAGTAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001110.1-984s1c1
Sequence:CCGGGCTGTGCAGATCATTCAGTATCTCGAGATACTGAATGATCTGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110.2-1802s21c1
Sequence:CCGGTTGAATCTGGCCAACCTATTTCTCGAGAAATAGGTTGGCCAGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110.2-2545s21c1
Sequence:CCGGGTTCATACTCCAAGTAGTAATCTCGAGATTACTACTTGGAGTATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007399
ADAM10 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-443s1c1
Sequence:CCGGGCAGAGAGATACATTAAAGATCTCGAGATCTTTAATGTATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-1229s1c1
Sequence:CCGGCCAGGAGAGTCTAAGAACTTACTCGAGTAAGTTCTTAGACTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-695s1c1
Sequence:CCGGCAGCTCTATATCCAGACAGATCTCGAGATCTGTCTGGATATAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-1810s1c1
Sequence:CCGGCCATGTTTGCTGCATGAAGAACTCGAGTTCTTCATGCAGCAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-2245s1c1
Sequence:CCGGGAGTTATCAAATGGGACACATCTCGAGATGTGTCCCATTTGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-1989s21c1
Sequence:CCGGCCATGTTTGCTGCATGAAGAACTCGAGTTCTTCATGCAGCAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-2424s21c1
Sequence:CCGGGAGTTATCAAATGGGACACATCTCGAGATGTGTCCCATTTGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-622s21c1
Sequence:CCGGGCAGAGAGATACATTAAAGATCTCGAGATCTTTAATGTATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-874s21c1
Sequence:CCGGCAGCTCTATATCCAGACAGATCTCGAGATCTGTCTGGATATAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-1408s21c1
Sequence:CCGGCCAGGAGAGTCTAAGAACTTACTCGAGTAAGTTCTTAGACTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007399
ADAM10 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-443s1c1
Sequence:CCGGGCAGAGAGATACATTAAAGATCTCGAGATCTTTAATGTATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-1229s1c1
Sequence:CCGGCCAGGAGAGTCTAAGAACTTACTCGAGTAAGTTCTTAGACTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-695s1c1
Sequence:CCGGCAGCTCTATATCCAGACAGATCTCGAGATCTGTCTGGATATAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-1810s1c1
Sequence:CCGGCCATGTTTGCTGCATGAAGAACTCGAGTTCTTCATGCAGCAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-2245s1c1
Sequence:CCGGGAGTTATCAAATGGGACACATCTCGAGATGTGTCCCATTTGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-1989s21c1
Sequence:CCGGCCATGTTTGCTGCATGAAGAACTCGAGTTCTTCATGCAGCAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-2424s21c1
Sequence:CCGGGAGTTATCAAATGGGACACATCTCGAGATGTGTCCCATTTGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-622s21c1
Sequence:CCGGGCAGAGAGATACATTAAAGATCTCGAGATCTTTAATGTATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-874s21c1
Sequence:CCGGCAGCTCTATATCCAGACAGATCTCGAGATCTGTCTGGATATAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-1408s21c1
Sequence:CCGGCCAGGAGAGTCTAAGAACTTACTCGAGTAAGTTCTTAGACTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007399
ADAM10 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-443s1c1
Sequence:CCGGGCAGAGAGATACATTAAAGATCTCGAGATCTTTAATGTATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-1229s1c1
Sequence:CCGGCCAGGAGAGTCTAAGAACTTACTCGAGTAAGTTCTTAGACTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-695s1c1
Sequence:CCGGCAGCTCTATATCCAGACAGATCTCGAGATCTGTCTGGATATAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-1810s1c1
Sequence:CCGGCCATGTTTGCTGCATGAAGAACTCGAGTTCTTCATGCAGCAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007399.1-2245s1c1
Sequence:CCGGGAGTTATCAAATGGGACACATCTCGAGATGTGTCCCATTTGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-1989s21c1
Sequence:CCGGCCATGTTTGCTGCATGAAGAACTCGAGTTCTTCATGCAGCAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-2424s21c1
Sequence:CCGGGAGTTATCAAATGGGACACATCTCGAGATGTGTCCCATTTGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-622s21c1
Sequence:CCGGGCAGAGAGATACATTAAAGATCTCGAGATCTTTAATGTATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-874s21c1
Sequence:CCGGCAGCTCTATATCCAGACAGATCTCGAGATCTGTCTGGATATAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007399.3-1408s21c1
Sequence:CCGGCCAGGAGAGTCTAAGAACTTACTCGAGTAAGTTCTTAGACTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks