EMAIL THIS PAGE TO A FRIEND

ADAM11

ADAM metallopeptidase domain 11

130 Gene Product Result for
Synonyms: MDC
UniProtKB ID: O75078, Q14808, Q14809, Q14810
Gene ID:
Human(4185) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease) protein family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene represents a candidate tumor supressor gene for human breast cancer based on its location within a minimal region of chromosome 17q21 previously defined by tumor deletion mapping. [provided by RefSeq, Jul 2008]
Mouse(11488) a disintegrin and metallopeptidase domain 11
Rat(360638) ADAM metallopeptidase domain 11
Zebrafish(567145) a disintegrin and metalloproteinase domain 11
cow(522375) ADAM metallopeptidase domain 11
Horse(100064340) ADAM metallopeptidase domain 11
domestic cat(101101679) ADAM metallopeptidase domain 11
dog(606958) ADAM metallopeptidase domain 11
chicken(428282) ADAM metallopeptidase domain 11
sheep(101117948) ADAM metallopeptidase domain 11
domestic guinea pig(100721219) ADAM metallopeptidase domain 11
naked mole-rat(101710505) ADAM metallopeptidase domain 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002390 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002390 Rosetta Predictions human pricing
NM_001108300 Rosetta Predictions rat pricing
NM_001110778 Rosetta Predictions mouse pricing
NM_009613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020880 predicted 706
2 SASI_Hs01_00020881 predicted 1066
3 SASI_Hs01_00020882 predicted 2749
4 SASI_Hs01_00020883 predicted 327
5 SASI_Hs01_00020884 predicted 2110
6 SASI_Hs01_00020885 predicted 707
7 SASI_Hs01_00020886 predicted 254
8 SASI_Hs01_00020887 predicted 2068
9 SASI_Hs01_00020889 predicted 1176
10 SASI_Hs02_00333746 predicted 1585
11 SASI_Hs01_00020888 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237299 predicted 340
2 SASI_Rn02_00237300 predicted 379
3 SASI_Rn02_00237301 predicted 1008
4 SASI_Rn02_00237302 predicted 659
5 SASI_Rn02_00237303 predicted 1629
6 SASI_Rn02_00237304 predicted 980
7 SASI_Rn02_00237305 predicted 439
8 SASI_Rn02_00237306 predicted 2307
9 SASI_Rn02_00237307 predicted 1573
10 SASI_Rn02_00237308 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305678 predicted 904
2 SASI_Mm02_00305679 predicted 906
3 SASI_Mm02_00305680 predicted 533
4 SASI_Mm02_00305681 predicted 1254
5 SASI_Mm02_00305682 predicted 902
6 SASI_Mm02_00305683 predicted 679
7 SASI_Mm02_00305684 predicted 1039
8 SASI_Mm02_00305685 predicted 930
9 SASI_Mm02_00305686 predicted 1710
10 SASI_Mm02_00305687 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165025 predicted 906
2 SASI_Mm01_00165026 predicted 907
3 SASI_Mm02_00316547 predicted 530
4 SASI_Mm02_00316548 predicted 1251
5 SASI_Mm01_00165027 predicted 903
6 SASI_Mm01_00165028 predicted 678
7 SASI_Mm01_00165029 predicted 1043
8 SASI_Mm01_00165030 predicted 924
9 SASI_Mm01_00165031 predicted 1705
10 SASI_Mm01_00165032 predicted 1788
11 SASI_Mm01_00165033 predicted 1218
12 SASI_Mm01_00165034 predicted 1994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002390
ADAM11 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002390.4-2753s21c1
Sequence:CCGGCTGAATCTTAATCGATGAATGCTCGAGCATTCATCGATTAAGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002390.4-2118s21c1
Sequence:CCGGCAAAGACTGCAGTATCCATAACTCGAGTTATGGATACTGCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-1689s1c1
Sequence:CCGGTGATCGCTTCTGCTACGAGAACTCGAGTTCTCGTAGCAGAAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-2171s1c1
Sequence:CCGGCGGAGAGATATAAAGGTCCCACTCGAGTGGGACCTTTATATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-819s1c1
Sequence:CCGGCGATGTGATATACAAGGAGCACTCGAGTGCTCCTTGTATATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-480s1c1
Sequence:CCGGTGATGGGAACTTGACTTACATCTCGAGATGTAAGTCAAGTTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-1591s1c1
Sequence:CCGGGACGGTTACTACTGTGACCATCTCGAGATGGTCACAGTAGTAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-819s1c2
Sequence:CCGGCGATGTGATATACAAGGAGCACTCGAGTGCTCCTTGTATATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002390
ADAM11 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002390.4-2753s21c1
Sequence:CCGGCTGAATCTTAATCGATGAATGCTCGAGCATTCATCGATTAAGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002390.4-2118s21c1
Sequence:CCGGCAAAGACTGCAGTATCCATAACTCGAGTTATGGATACTGCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-1689s1c1
Sequence:CCGGTGATCGCTTCTGCTACGAGAACTCGAGTTCTCGTAGCAGAAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-2171s1c1
Sequence:CCGGCGGAGAGATATAAAGGTCCCACTCGAGTGGGACCTTTATATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-819s1c1
Sequence:CCGGCGATGTGATATACAAGGAGCACTCGAGTGCTCCTTGTATATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-480s1c1
Sequence:CCGGTGATGGGAACTTGACTTACATCTCGAGATGTAAGTCAAGTTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-1591s1c1
Sequence:CCGGGACGGTTACTACTGTGACCATCTCGAGATGGTCACAGTAGTAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-819s1c2
Sequence:CCGGCGATGTGATATACAAGGAGCACTCGAGTGCTCCTTGTATATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002390
ADAM11 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002390.4-2753s21c1
Sequence:CCGGCTGAATCTTAATCGATGAATGCTCGAGCATTCATCGATTAAGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002390.4-2118s21c1
Sequence:CCGGCAAAGACTGCAGTATCCATAACTCGAGTTATGGATACTGCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-1689s1c1
Sequence:CCGGTGATCGCTTCTGCTACGAGAACTCGAGTTCTCGTAGCAGAAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-2171s1c1
Sequence:CCGGCGGAGAGATATAAAGGTCCCACTCGAGTGGGACCTTTATATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-819s1c1
Sequence:CCGGCGATGTGATATACAAGGAGCACTCGAGTGCTCCTTGTATATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-480s1c1
Sequence:CCGGTGATGGGAACTTGACTTACATCTCGAGATGTAAGTCAAGTTCCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-1591s1c1
Sequence:CCGGGACGGTTACTACTGTGACCATCTCGAGATGGTCACAGTAGTAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002390.2-819s1c2
Sequence:CCGGCGATGTGATATACAAGGAGCACTCGAGTGCTCCTTGTATATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009613
ADAM11 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 11
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-1281s1c1
Sequence:CCGGCATCGACGAATACAACCAGTTCTCGAGAACTGGTTGTATTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-1615s1c1
Sequence:CCGGCTGGACGGTTACTACTGTGATCTCGAGATCACAGTAGTAACCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-844s1c1
Sequence:CCGGGCAGATGTGATATACAAGGAACTCGAGTTCCTTGTATATCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-519s1c1
Sequence:CCGGGACTTACATCGTAGAGCCTAACTCGAGTTAGGCTCTACGATGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009613
ADAM11 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 11
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-1281s1c1
Sequence:CCGGCATCGACGAATACAACCAGTTCTCGAGAACTGGTTGTATTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-1615s1c1
Sequence:CCGGCTGGACGGTTACTACTGTGATCTCGAGATCACAGTAGTAACCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-844s1c1
Sequence:CCGGGCAGATGTGATATACAAGGAACTCGAGTTCCTTGTATATCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-519s1c1
Sequence:CCGGGACTTACATCGTAGAGCCTAACTCGAGTTAGGCTCTACGATGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009613
ADAM11 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 11
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-1281s1c1
Sequence:CCGGCATCGACGAATACAACCAGTTCTCGAGAACTGGTTGTATTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-1615s1c1
Sequence:CCGGCTGGACGGTTACTACTGTGATCTCGAGATCACAGTAGTAACCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-844s1c1
Sequence:CCGGGCAGATGTGATATACAAGGAACTCGAGTTCCTTGTATATCACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009613.1-519s1c1
Sequence:CCGGGACTTACATCGTAGAGCCTAACTCGAGTTAGGCTCTACGATGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks