EMAIL THIS PAGE TO A FRIEND

ADAM12

ADAM metallopeptidase domain 12

159 Gene Product Result for
Synonyms: MCMP MCMPMltna MLTN MLTNA
UniProtKB ID: O43184, O60470, Q5JRP0, Q5JRP1, Q6P9E3, Q6UWB0
Gene ID:
Human(8038) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease) protein family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene has two alternatively spliced transcripts: a shorter secreted form and a longer membrane-bound form. The shorter form is found to stimulate myogenesis. [provided by RefSeq, Jul 2008]
Mouse(11489) a disintegrin and metallopeptidase domain 12 (meltrin alpha)
Rat(679837) ADAM metallopeptidase domain 12
naked mole-rat(101701778) ADAM metallopeptidase domain 12
domestic guinea pig(100735152) ADAM metallopeptidase domain 12
sheep(101106128) ADAM metallopeptidase domain 12
Zebrafish(563275) a disintegrin and metalloproteinase domain 12 (meltrin alpha)
cow(407229) ADAM metallopeptidase domain 12
Horse(100056196) ADAM metallopeptidase domain 12
domestic cat(101081333) ADAM metallopeptidase domain 12
dog(100686018) ADAM metallopeptidase domain 12
chicken(425843) ADAM metallopeptidase domain 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1248 Human ADAM-12 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003474 siRNAs that have been validated in the lab human pricing
NM_021641 Rosetta Predictions human pricing
XM_001054670 Rosetta Predictions rat pricing
NM_007400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003474 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235577 validated 2133
1 SASI_Hs01_00235578 validated 1907
1 SASI_Hs01_00235576 validated 900
2 SASI_Hs01_00235580 predicted 1181
3 SASI_Hs01_00235581 predicted 660
4 SASI_Hs02_00335734 predicted 2047
5 SASI_Hs01_00235582 predicted 1064
6 SASI_Hs01_00235584 predicted 1105
7 SASI_Hs01_00235585 predicted 640
8 SASI_Hs02_00335735 predicted 1582
9 SASI_Hs01_00235579 predicted 807
10 SASI_Hs01_00235583 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098356 predicted 896
2 SASI_Hs01_00098357 predicted 2133
3 SASI_Hs01_00098358 predicted 1911
4 SASI_Hs01_00098360 predicted 1180
5 SASI_Hs01_00098361 predicted 654
6 SASI_Hs02_00355001 predicted 2044
7 SASI_Hs01_00098362 predicted 1068
8 SASI_Hs01_00098364 predicted 1107
9 SASI_Hs01_00098365 predicted 636
10 SASI_Hs02_00355002 predicted 1576
11 SASI_Hs01_00098359 predicted 806
12 SASI_Hs01_00098363 predicted 2005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276747 predicted 664
2 SASI_Rn02_00276748 predicted 944
3 SASI_Rn02_00276749 predicted 1001
4 SASI_Rn02_00276750 predicted 2378
5 SASI_Rn02_00276751 predicted 537
6 SASI_Rn02_00276752 predicted 926
7 SASI_Rn02_00276753 predicted 1996
8 SASI_Rn02_00276754 predicted 1016
9 SASI_Rn02_00276755 predicted 1027
10 SASI_Rn02_00276756 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094943 predicted 845
2 SASI_Mm01_00094944 predicted 554
3 SASI_Mm01_00094946 predicted 2807
4 SASI_Mm01_00094947 predicted 1077
5 SASI_Mm01_00094948 predicted 1997
6 SASI_Mm01_00094949 predicted 2959
7 SASI_Mm02_00311513 predicted 847
8 SASI_Mm02_00311514 predicted 3008
9 SASI_Mm01_00094952 predicted 1026
10 SASI_Mm02_00311515 predicted 1503
11 SASI_Mm01_00094945 predicted 1049
12 SASI_Mm01_00094950 predicted 825
13 SASI_Mm01_00094951 predicted 2147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003474
VALIDATED
ADAM12 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-4411s1c1
Sequence:CCGGGCCATGTTTCACAAGGTCTTTCTCGAGAAAGACCTTGTGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-2237s1c1
Sequence:CCGGGCCTGAATCGTCAATGTCAAACTCGAGTTTGACATTGACGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-1192s1c1
Sequence:CCGGCCTCGCAAATCCCATGACAATCTCGAGATTGTCATGGGATTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-630s1c1
Sequence:CCGGCGCTCGAAATTACACGGTAATCTCGAGATTACCGTGTAATTTCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003474.2-2470s1c1
Sequence:CCGGGCTGCCGGATTTGTGGTTTATCTCGAGATAAACCACAAATCCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-2131s21c1
Sequence:CCGGGCGAGATGAGAGATGCTAAATCTCGAGATTTAGCATCTCTCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-3117s21c1
Sequence:CCGGTCCACCCACACCGCCTATATTCTCGAGAATATAGGCGGTGTGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-1035s21c1
Sequence:CCGGGAGACCCTCAAGGCAACTAAGCTCGAGCTTAGTTGCCTTGAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003474
VALIDATED
ADAM12 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-4411s1c1
Sequence:CCGGGCCATGTTTCACAAGGTCTTTCTCGAGAAAGACCTTGTGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-2237s1c1
Sequence:CCGGGCCTGAATCGTCAATGTCAAACTCGAGTTTGACATTGACGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-1192s1c1
Sequence:CCGGCCTCGCAAATCCCATGACAATCTCGAGATTGTCATGGGATTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-630s1c1
Sequence:CCGGCGCTCGAAATTACACGGTAATCTCGAGATTACCGTGTAATTTCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003474.2-2470s1c1
Sequence:CCGGGCTGCCGGATTTGTGGTTTATCTCGAGATAAACCACAAATCCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-2131s21c1
Sequence:CCGGGCGAGATGAGAGATGCTAAATCTCGAGATTTAGCATCTCTCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-3117s21c1
Sequence:CCGGTCCACCCACACCGCCTATATTCTCGAGAATATAGGCGGTGTGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-1035s21c1
Sequence:CCGGGAGACCCTCAAGGCAACTAAGCTCGAGCTTAGTTGCCTTGAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003474
VALIDATED
ADAM12 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-4411s1c1
Sequence:CCGGGCCATGTTTCACAAGGTCTTTCTCGAGAAAGACCTTGTGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-2237s1c1
Sequence:CCGGGCCTGAATCGTCAATGTCAAACTCGAGTTTGACATTGACGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-1192s1c1
Sequence:CCGGCCTCGCAAATCCCATGACAATCTCGAGATTGTCATGGGATTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003474.2-630s1c1
Sequence:CCGGCGCTCGAAATTACACGGTAATCTCGAGATTACCGTGTAATTTCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003474.2-2470s1c1
Sequence:CCGGGCTGCCGGATTTGTGGTTTATCTCGAGATAAACCACAAATCCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-2131s21c1
Sequence:CCGGGCGAGATGAGAGATGCTAAATCTCGAGATTTAGCATCTCTCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-3117s21c1
Sequence:CCGGTCCACCCACACCGCCTATATTCTCGAGAATATAGGCGGTGTGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003474.4-1035s21c1
Sequence:CCGGGAGACCCTCAAGGCAACTAAGCTCGAGCTTAGTTGCCTTGAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007400
ADAM12 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-2420s1c1
Sequence:CCGGCGGCTGCTGTTCACACATAAACTCGAGTTTATGTGTGAACAGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-1724s1c1
Sequence:CCGGGCCAATGTGTACCTACATGATCTCGAGATCATGTAGGTACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-2378s1c1
Sequence:CCGGGCTGCTGGATTTGTGGTGTATCTCGAGATACACCACAAATCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-865s1c1
Sequence:CCGGGCTGGTTATTGTGGCAGACAACTCGAGTTGTCTGCCACAATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-1886s1c1
Sequence:CCGGCCTTATGGTAACTGTGGCAAACTCGAGTTTGCCACAGTTACCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007400
ADAM12 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-2420s1c1
Sequence:CCGGCGGCTGCTGTTCACACATAAACTCGAGTTTATGTGTGAACAGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-1724s1c1
Sequence:CCGGGCCAATGTGTACCTACATGATCTCGAGATCATGTAGGTACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-2378s1c1
Sequence:CCGGGCTGCTGGATTTGTGGTGTATCTCGAGATACACCACAAATCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-865s1c1
Sequence:CCGGGCTGGTTATTGTGGCAGACAACTCGAGTTGTCTGCCACAATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-1886s1c1
Sequence:CCGGCCTTATGGTAACTGTGGCAAACTCGAGTTTGCCACAGTTACCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007400
ADAM12 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-2420s1c1
Sequence:CCGGCGGCTGCTGTTCACACATAAACTCGAGTTTATGTGTGAACAGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-1724s1c1
Sequence:CCGGGCCAATGTGTACCTACATGATCTCGAGATCATGTAGGTACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-2378s1c1
Sequence:CCGGGCTGCTGGATTTGTGGTGTATCTCGAGATACACCACAAATCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-865s1c1
Sequence:CCGGGCTGGTTATTGTGGCAGACAACTCGAGTTGTCTGCCACAATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007400.1-1886s1c1
Sequence:CCGGCCTTATGGTAACTGTGGCAAACTCGAGTTTGCCACAGTTACCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks