EMAIL THIS PAGE TO A FRIEND

ADAM15

ADAM metallopeptidase domain 15

264 Gene Product Result for
Synonyms: MDC15
Gene ID:
Human(8751) Summary: The protein encoded by this gene is a member of the ADAM (a disintegrin and metalloproteinase) protein family. ADAM family members are type I transmembrane glycoproteins known to be involved in cell adhesion and proteolytic ectodomain processing of cytokines and adhesion molecules. This protein contains multiple functional domains including a zinc-binding metalloprotease domain, a disintegrin-like domain, as well as a EGF-like domain. Through its disintegrin-like domain, this protein specifically interacts with the integrin beta chain, beta 3. It also interacts with Src family protein-tyrosine kinases in a phosphorylation-dependent manner, suggesting that this protein may function in cell-cell adhesion as well as in cellular signaling. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(11490) a disintegrin and metallopeptidase domain 15 (metargidin)
Rat(57025) ADAM metallopeptidase domain 15
chicken(419050) ADAM metallopeptidase domain 15
Horse(100063219) ADAM metallopeptidase domain 15
cow(784605) ADAM metallopeptidase domain 15
domestic cat(101095312) ADAM metallopeptidase domain 15
dog(490434) ADAM metallopeptidase domain 15
sheep(101105128) ADAM metallopeptidase domain 15
Domestic Rabbit(100339079) ADAM metallopeptidase domain 15
domestic guinea pig(100736139) ADAM metallopeptidase domain 15
naked mole-rat(101712049) ADAM metallopeptidase domain 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003815 siRNAs that have been validated in the lab human pricing
NM_207191 Rosetta Predictions human pricing
NM_207194 Rosetta Predictions human pricing
NM_207195 Rosetta Predictions human pricing
NM_207196 Rosetta Predictions human pricing
NM_207197 Rosetta Predictions human pricing
NM_020308 Rosetta Predictions rat pricing
NM_001037722 Rosetta Predictions mouse pricing
NM_009614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003815 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069322 validated 1882
1 SASI_Hs01_00069324 validated 592
1 SASI_Hs01_00069323 validated 1169
2 SASI_Hs01_00069325 predicted 1356
3 SASI_Hs01_00069327 predicted 960
4 SASI_Hs01_00069328 predicted 1881
5 SASI_Hs01_00069329 predicted 1547
6 SASI_Hs01_00069330 predicted 1825
7 SASI_Hs01_00069331 predicted 590
8 SASI_Hs02_00336357 predicted 1236
9 SASI_Hs01_00069326 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116895 predicted 1883
2 SASI_Hs01_00116896 predicted 1166
3 SASI_Hs01_00116897 predicted 587
4 SASI_Hs01_00116898 predicted 1364
5 SASI_Hs01_00116900 predicted 969
6 SASI_Hs01_00116901 predicted 1884
7 SASI_Hs01_00116902 predicted 1549
8 SASI_Hs01_00116903 predicted 1821
9 SASI_Hs01_00116904 predicted 583
10 SASI_Hs02_00373816 predicted 1241
11 SASI_Hs01_00116899 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071073 predicted 1881
2 SASI_Hs01_00071074 predicted 1167
3 SASI_Hs01_00071075 predicted 583
4 SASI_Hs01_00071076 predicted 1362
5 SASI_Hs01_00071078 predicted 961
6 SASI_Hs01_00071079 predicted 1884
7 SASI_Hs01_00071080 predicted 1551
8 SASI_Hs01_00071081 predicted 1827
9 SASI_Hs01_00071082 predicted 582
10 SASI_Hs02_00373817 predicted 1237
11 SASI_Hs01_00071077 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017414 predicted 1882
2 SASI_Hs01_00017415 predicted 1166
3 SASI_Hs01_00017416 predicted 589
4 SASI_Hs01_00017417 predicted 1358
5 SASI_Hs01_00017419 predicted 965
6 SASI_Hs01_00017420 predicted 1882
7 SASI_Hs01_00017421 predicted 1555
8 SASI_Hs01_00017422 predicted 1823
9 SASI_Hs01_00017423 predicted 582
10 SASI_Hs02_00373818 predicted 1245
11 SASI_Hs01_00017418 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213173 predicted 1888
2 SASI_Hs01_00213174 predicted 1162
3 SASI_Hs01_00213175 predicted 590
4 SASI_Hs01_00213176 predicted 1356
5 SASI_Hs01_00213178 predicted 969
6 SASI_Hs01_00213179 predicted 1881
7 SASI_Hs01_00213180 predicted 1556
8 SASI_Hs01_00213181 predicted 1822
9 SASI_Hs01_00213182 predicted 586
10 SASI_Hs02_00373819 predicted 1244
11 SASI_Hs01_00213177 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035215 predicted 1881
2 SASI_Hs01_00035216 predicted 1163
3 SASI_Hs01_00035217 predicted 585
4 SASI_Hs01_00035218 predicted 1360
5 SASI_Hs01_00035220 predicted 960
6 SASI_Hs01_00035221 predicted 1888
7 SASI_Hs01_00035222 predicted 1549
8 SASI_Hs01_00035223 predicted 1820
9 SASI_Hs01_00035224 predicted 584
10 SASI_Hs02_00373820 predicted 1245
11 SASI_Hs01_00035219 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055139 predicted 740
2 SASI_Rn01_00055140 predicted 764
3 SASI_Rn01_00055141 predicted 326
4 SASI_Rn02_00262552 predicted 574
5 SASI_Rn02_00262553 predicted 698
6 SASI_Rn01_00055142 predicted 1061
7 SASI_Rn01_00055143 predicted 1559
8 SASI_Rn01_00055144 predicted 1037
9 SASI_Rn01_00055146 predicted 784
10 SASI_Rn01_00055147 predicted 892
11 SASI_Rn01_00055138 predicted 2290
12 SASI_Rn01_00055145 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117523 predicted 1266
2 SASI_Mm01_00117525 predicted 1594
3 SASI_Mm01_00117526 predicted 1466
4 SASI_Mm01_00117527 predicted 354
5 SASI_Mm01_00117528 predicted 1166
6 SASI_Mm01_00117530 predicted 1893
7 SASI_Mm02_00289341 predicted 354
8 SASI_Mm02_00289342 predicted 1282
9 SASI_Mm02_00289343 predicted 1033
10 SASI_Mm02_00289344 predicted 1393
11 SASI_Mm01_00117521 predicted 779
12 SASI_Mm01_00117522 predicted 736
13 SASI_Mm01_00117524 predicted 785
14 SASI_Mm01_00117529 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041226 predicted 1261
2 SASI_Mm01_00041228 predicted 1590
3 SASI_Mm01_00041229 predicted 1473
4 SASI_Mm01_00041230 predicted 355
5 SASI_Mm01_00041231 predicted 1160
6 SASI_Mm01_00041233 predicted 1890
7 SASI_Mm02_00316549 predicted 353
8 SASI_Mm02_00316550 predicted 1279
9 SASI_Mm02_00316551 predicted 1028
10 SASI_Mm02_00316552 predicted 1388
11 SASI_Mm01_00041224 predicted 775
12 SASI_Mm01_00041225 predicted 738
13 SASI_Mm01_00041227 predicted 782
14 SASI_Mm01_00041232 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003815
ADAM15 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1890s21c1
Sequence:CCGGGATCTACTCTGGGAGACAATACTCGAGTATTGTCTCCCAGAGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1736s21c1
Sequence:CCGGTTGCCTCCAGACAGCTAATACCTCGAGGTATTAGCTGTCTGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1361s21c1
Sequence:CCGGGGCTGCTTTCTGCGGAAATATCTCGAGATATTTCCGCAGAAAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-497s1c1
Sequence:CCGGCCCATTATTTCGCGAATCCAACTCGAGTTGGATTCGCGAAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-1076s1c1
Sequence:CCGGGACCATGATTTGCCTGGGAATCTCGAGATTCCCAGGCAAATCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-913s1c1
Sequence:CCGGGCTGGTGACTGGTACTTCATTCTCGAGAATGAAGTACCAGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-161s1c1
Sequence:CCGGGATCTCCCAATTAGCCTCAAACTCGAGTTTGAGGCTAATTGGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-1339s1c1
Sequence:CCGGCGATCCCTGCTGTGATTCTTTCTCGAGAAAGAATCACAGCAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003815
ADAM15 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1890s21c1
Sequence:CCGGGATCTACTCTGGGAGACAATACTCGAGTATTGTCTCCCAGAGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1736s21c1
Sequence:CCGGTTGCCTCCAGACAGCTAATACCTCGAGGTATTAGCTGTCTGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1361s21c1
Sequence:CCGGGGCTGCTTTCTGCGGAAATATCTCGAGATATTTCCGCAGAAAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-497s1c1
Sequence:CCGGCCCATTATTTCGCGAATCCAACTCGAGTTGGATTCGCGAAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-1076s1c1
Sequence:CCGGGACCATGATTTGCCTGGGAATCTCGAGATTCCCAGGCAAATCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-913s1c1
Sequence:CCGGGCTGGTGACTGGTACTTCATTCTCGAGAATGAAGTACCAGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-161s1c1
Sequence:CCGGGATCTCCCAATTAGCCTCAAACTCGAGTTTGAGGCTAATTGGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-1339s1c1
Sequence:CCGGCGATCCCTGCTGTGATTCTTTCTCGAGAAAGAATCACAGCAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003815
ADAM15 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1890s21c1
Sequence:CCGGGATCTACTCTGGGAGACAATACTCGAGTATTGTCTCCCAGAGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1736s21c1
Sequence:CCGGTTGCCTCCAGACAGCTAATACCTCGAGGTATTAGCTGTCTGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003815.3-1361s21c1
Sequence:CCGGGGCTGCTTTCTGCGGAAATATCTCGAGATATTTCCGCAGAAAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-497s1c1
Sequence:CCGGCCCATTATTTCGCGAATCCAACTCGAGTTGGATTCGCGAAATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-1076s1c1
Sequence:CCGGGACCATGATTTGCCTGGGAATCTCGAGATTCCCAGGCAAATCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-913s1c1
Sequence:CCGGGCTGGTGACTGGTACTTCATTCTCGAGAATGAAGTACCAGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-161s1c1
Sequence:CCGGGATCTCCCAATTAGCCTCAAACTCGAGTTTGAGGCTAATTGGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003815.2-1339s1c1
Sequence:CCGGCGATCCCTGCTGTGATTCTTTCTCGAGAAAGAATCACAGCAGGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009614
VALIDATED
ADAM15 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-1386s21c1
Sequence:CCGGGTCCTCTTTGTGTGGAAATATCTCGAGATATTTCCACACAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-2084s21c1
Sequence:CCGGGAGCACAGGAATGTCGAAGAACTCGAGTTCTTCGACATTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-774s21c1
Sequence:CCGGGTTGGTGATTGTGGCTGATAACTCGAGTTATCAGCCACAATCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-301s21c1
Sequence:CCGGGACGTGCTTCAGACTGGTTTACTCGAGTAAACCAGTCTGAAGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-1347s1c1
Sequence:CCGGGTCCTCTTTGTGTGGAAATATCTCGAGATATTTCCACACAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009614.1-2045s1c1
Sequence:CCGGGAGCACAGGAATGTCGAAGAACTCGAGTTCTTCGACATTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009614.1-262s1c1
Sequence:CCGGGACGTGCTTCAGACTGGTTTACTCGAGTAAACCAGTCTGAAGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-1200s1c1
Sequence:CCGGCCCGGCTAAGAGCTGCATCATCTCGAGATGATGCAGCTCTTAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-735s1c1
Sequence:CCGGGTTGGTGATTGTGGCTGATAACTCGAGTTATCAGCCACAATCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009614
VALIDATED
ADAM15 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-1386s21c1
Sequence:CCGGGTCCTCTTTGTGTGGAAATATCTCGAGATATTTCCACACAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-2084s21c1
Sequence:CCGGGAGCACAGGAATGTCGAAGAACTCGAGTTCTTCGACATTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-774s21c1
Sequence:CCGGGTTGGTGATTGTGGCTGATAACTCGAGTTATCAGCCACAATCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-301s21c1
Sequence:CCGGGACGTGCTTCAGACTGGTTTACTCGAGTAAACCAGTCTGAAGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-1347s1c1
Sequence:CCGGGTCCTCTTTGTGTGGAAATATCTCGAGATATTTCCACACAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009614.1-2045s1c1
Sequence:CCGGGAGCACAGGAATGTCGAAGAACTCGAGTTCTTCGACATTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009614.1-262s1c1
Sequence:CCGGGACGTGCTTCAGACTGGTTTACTCGAGTAAACCAGTCTGAAGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-1200s1c1
Sequence:CCGGCCCGGCTAAGAGCTGCATCATCTCGAGATGATGCAGCTCTTAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-735s1c1
Sequence:CCGGGTTGGTGATTGTGGCTGATAACTCGAGTTATCAGCCACAATCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009614
VALIDATED
ADAM15 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-1386s21c1
Sequence:CCGGGTCCTCTTTGTGTGGAAATATCTCGAGATATTTCCACACAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-2084s21c1
Sequence:CCGGGAGCACAGGAATGTCGAAGAACTCGAGTTCTTCGACATTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-774s21c1
Sequence:CCGGGTTGGTGATTGTGGCTGATAACTCGAGTTATCAGCCACAATCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009614.2-301s21c1
Sequence:CCGGGACGTGCTTCAGACTGGTTTACTCGAGTAAACCAGTCTGAAGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-1347s1c1
Sequence:CCGGGTCCTCTTTGTGTGGAAATATCTCGAGATATTTCCACACAAAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009614.1-2045s1c1
Sequence:CCGGGAGCACAGGAATGTCGAAGAACTCGAGTTCTTCGACATTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009614.1-262s1c1
Sequence:CCGGGACGTGCTTCAGACTGGTTTACTCGAGTAAACCAGTCTGAAGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-1200s1c1
Sequence:CCGGCCCGGCTAAGAGCTGCATCATCTCGAGATGATGCAGCTCTTAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009614.1-735s1c1
Sequence:CCGGGTTGGTGATTGTGGCTGATAACTCGAGTTATCAGCCACAATCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks