EMAIL THIS PAGE TO A FRIEND

ADAM17

ADAM metallopeptidase domain 17

69 Gene Product Result for
Synonyms: ADAM18 CD156B CSVP NISBD TACE
UniProtKB ID: P78536, O60226
Gene ID:
Human(6868) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene functions as a tumor necrosis factor-alpha converting enzyme; binds mitotic arrest deficient 2 protein; and also plays a prominent role in the activation of the Notch signaling pathway. [provided by RefSeq, Jul 2008]
Mouse(11491) a disintegrin and metallopeptidase domain 17
Rat(57027) ADAM metallopeptidase domain 17
naked mole-rat(101720924) ADAM metallopeptidase domain 17
domestic guinea pig(100732916) ADAM metallopeptidase domain 17
sheep(101116815) ADAM metallopeptidase domain 17
chicken(421931) ADAM metallopeptidase domain 17
cow(517541) ADAM metallopeptidase domain 17
Horse(100072496) ADAM metallopeptidase domain 17
domestic cat(101089004) ADAM metallopeptidase domain 17
dog(475662) ADAM metallopeptidase domain 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502912 Anti-ADAM 17 (Cleaved-Arg215) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4502911 Anti-ADAM 17, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence pricing
T5442 Anti-ADAM-17 (TACE), C-Terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
microarray, western blot pricing
A4351 Anti-ADAM-17, Cytoplasmic Domain antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution rat, human, pig
western blot pricing
A4226 Anti-ADAM-17, Propeptide Domain antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution pig, human, rat
western blot pricing
HPA010738 Anti-ADAM17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA051575 Anti-ADAM17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2500028 Anti-ADAM17/TACE antibody produced in goat affinity isolated antibody, buffered aqueous solution Chinese hamster, human
ELISA, immunohistochemistry, western blot pricing
SAB4504073 Anti-phospho-ADAM 17 (pThr735) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301529 Anti-phospho-ADAM 17 (pThr735) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB3500367 Anti-TACE antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, flow cytometry, immunocytochemistry, immunofluorescence, western blot pricing
WH0006868M1 Monoclonal Anti-ADAM17 antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK218 Tace Inhibitor Screening Assay Kit Sufficient for 100 Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003183 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003183 Rosetta Predictions human pricing
NM_020306 Rosetta Predictions rat pricing
NM_009615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027257 predicted 426
2 SASI_Hs01_00027258 predicted 2753
3 SASI_Hs01_00027259 predicted 2117
4 SASI_Hs01_00027261 predicted 302
5 SASI_Hs02_00335210 predicted 2638
6 SASI_Hs02_00335211 predicted 907
7 SASI_Hs02_00335212 predicted 1551
8 SASI_Hs01_00027262 predicted 357
9 SASI_Hs01_00027263 predicted 1217
10 SASI_Hs01_00027264 predicted 1531
11 SASI_Hs01_00027256 predicted 1139
12 SASI_Hs01_00027260 predicted 380
13 SASI_Hs01_00027265 predicted 2268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098628 predicted 1875
2 SASI_Rn01_00098630 predicted 1657
3 SASI_Rn01_00098631 predicted 1842
4 SASI_Rn01_00098632 predicted 618
5 SASI_Rn01_00098633 predicted 412
6 SASI_Rn01_00098634 predicted 974
7 SASI_Rn01_00098635 predicted 1066
8 SASI_Rn01_00098636 predicted 1083
9 SASI_Rn02_00262551 predicted 765
10 SASI_Rn01_00098637 predicted 2054
11 SASI_Rn01_00098629 predicted 2668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083935 predicted 1793
2 SASI_Mm01_00083936 predicted 2079
3 SASI_Mm02_00316553 predicted 1032
4 SASI_Mm02_00316554 predicted 1446
5 SASI_Mm01_00083937 predicted 1524
6 SASI_Mm01_00083938 predicted 984
7 SASI_Mm01_00083941 predicted 532
8 SASI_Mm01_00083942 predicted 325
9 SASI_Mm01_00083943 predicted 2583
10 SASI_Mm01_00083940 predicted 957
11 SASI_Mm01_00083939 predicted 417
12 SASI_Mm01_00083944 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003183
VALIDATED
ADAM17 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-314s1c1
Sequence:CCGGCCAGCAGCATTCGGTAAGAAACTCGAGTTTCTTACCGAATGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-2597s1c1
Sequence:CCGGGCAGCGTCAGAATCGTGTTAACTCGAGTTAACACGATTCTGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-822s1c1
Sequence:CCGGCCCATGAAGAACACGTGTAAACTCGAGTTTACACGTGTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-1364s1c1
Sequence:CCGGCCTGGTTACAACTCATGAATTCTCGAGAATTCATGAGTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-2002s1c1
Sequence:CCGGCCTATGTCGATGCTGAACAAACTCGAGTTTGTTCAGCATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-333s21c1
Sequence:CCGGCCAGCAGCATTCGGTAAGAAACTCGAGTTTCTTACCGAATGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-2846s21c1
Sequence:CCGGGAAGGTGAATCTAGCTTATTTCTCGAGAAATAAGCTAGATTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003183.4-2021s21c1
Sequence:CCGGCCTATGTCGATGCTGAACAAACTCGAGTTTGTTCAGCATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003183.4-1383s21c1
Sequence:CCGGCCTGGTTACAACTCATGAATTCTCGAGAATTCATGAGTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-1273s21c1
Sequence:CCGGGTTTGTCCAAAGGCTTATTATCTCGAGATAATAAGCCTTTGGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003183
VALIDATED
ADAM17 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-314s1c1
Sequence:CCGGCCAGCAGCATTCGGTAAGAAACTCGAGTTTCTTACCGAATGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-2597s1c1
Sequence:CCGGGCAGCGTCAGAATCGTGTTAACTCGAGTTAACACGATTCTGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-822s1c1
Sequence:CCGGCCCATGAAGAACACGTGTAAACTCGAGTTTACACGTGTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-1364s1c1
Sequence:CCGGCCTGGTTACAACTCATGAATTCTCGAGAATTCATGAGTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-2002s1c1
Sequence:CCGGCCTATGTCGATGCTGAACAAACTCGAGTTTGTTCAGCATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-333s21c1
Sequence:CCGGCCAGCAGCATTCGGTAAGAAACTCGAGTTTCTTACCGAATGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-2846s21c1
Sequence:CCGGGAAGGTGAATCTAGCTTATTTCTCGAGAAATAAGCTAGATTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003183.4-2021s21c1
Sequence:CCGGCCTATGTCGATGCTGAACAAACTCGAGTTTGTTCAGCATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003183.4-1383s21c1
Sequence:CCGGCCTGGTTACAACTCATGAATTCTCGAGAATTCATGAGTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-1273s21c1
Sequence:CCGGGTTTGTCCAAAGGCTTATTATCTCGAGATAATAAGCCTTTGGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003183
VALIDATED
ADAM17 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-314s1c1
Sequence:CCGGCCAGCAGCATTCGGTAAGAAACTCGAGTTTCTTACCGAATGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-2597s1c1
Sequence:CCGGGCAGCGTCAGAATCGTGTTAACTCGAGTTAACACGATTCTGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-822s1c1
Sequence:CCGGCCCATGAAGAACACGTGTAAACTCGAGTTTACACGTGTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-1364s1c1
Sequence:CCGGCCTGGTTACAACTCATGAATTCTCGAGAATTCATGAGTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003183.3-2002s1c1
Sequence:CCGGCCTATGTCGATGCTGAACAAACTCGAGTTTGTTCAGCATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-333s21c1
Sequence:CCGGCCAGCAGCATTCGGTAAGAAACTCGAGTTTCTTACCGAATGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-2846s21c1
Sequence:CCGGGAAGGTGAATCTAGCTTATTTCTCGAGAAATAAGCTAGATTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003183.4-2021s21c1
Sequence:CCGGCCTATGTCGATGCTGAACAAACTCGAGTTTGTTCAGCATCGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003183.4-1383s21c1
Sequence:CCGGCCTGGTTACAACTCATGAATTCTCGAGAATTCATGAGTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003183.4-1273s21c1
Sequence:CCGGGTTTGTCCAAAGGCTTATTATCTCGAGATAATAAGCCTTTGGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009615
VALIDATED
ADAM17 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009615.4-250s1c1
Sequence:CCGGCGCGACTTGAGAAGCTTGATTCTCGAGAATCAAGCTTCTCAAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-1483s1c1
Sequence:CCGGGCGGTGACCATGAGAATAATACTCGAGTATTATTCTCATGGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-348s1c1
Sequence:CCGGGCGACACACTTAGAAACATTACTCGAGTAATGTTTCTAAGTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009615.4-819s1c1
Sequence:CCGGCCCTTGAAGAATACTTGTAAACTCGAGTTTACAAGTATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-958s1c1
Sequence:CCGGCGTGGGATAATGCAGGGTTTACTCGAGTAAACCCTGCATTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009615
VALIDATED
ADAM17 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009615.4-250s1c1
Sequence:CCGGCGCGACTTGAGAAGCTTGATTCTCGAGAATCAAGCTTCTCAAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-1483s1c1
Sequence:CCGGGCGGTGACCATGAGAATAATACTCGAGTATTATTCTCATGGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-348s1c1
Sequence:CCGGGCGACACACTTAGAAACATTACTCGAGTAATGTTTCTAAGTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009615.4-819s1c1
Sequence:CCGGCCCTTGAAGAATACTTGTAAACTCGAGTTTACAAGTATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-958s1c1
Sequence:CCGGCGTGGGATAATGCAGGGTTTACTCGAGTAAACCCTGCATTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009615
VALIDATED
ADAM17 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009615.4-250s1c1
Sequence:CCGGCGCGACTTGAGAAGCTTGATTCTCGAGAATCAAGCTTCTCAAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-1483s1c1
Sequence:CCGGGCGGTGACCATGAGAATAATACTCGAGTATTATTCTCATGGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-348s1c1
Sequence:CCGGGCGACACACTTAGAAACATTACTCGAGTAATGTTTCTAAGTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009615.4-819s1c1
Sequence:CCGGCCCTTGAAGAATACTTGTAAACTCGAGTTTACAAGTATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009615.4-958s1c1
Sequence:CCGGCGTGGGATAATGCAGGGTTTACTCGAGTAAACCCTGCATTATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks