EMAIL THIS PAGE TO A FRIEND

ADAM18

ADAM metallopeptidase domain 18

60 Gene Product Result for
Synonyms: ADAM27 tMDCIII
UniProtKB ID: Q9Y3Q7, B2R9Y0, Q0VAI4, Q6IRW9, Q6UXJ9
Gene ID:
Human(8749) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene is a sperm surface protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(13524) a disintegrin and metallopeptidase domain 18
Rat(57029) ADAM metallopeptidase domain 18
cow(536257) ADAM metallopeptidase domain 18
dog(607708) ADAM metallopeptidase domain 18
sheep(101120301) ADAM metallopeptidase domain 18
domestic guinea pig(100728591) ADAM metallopeptidase domain 18
naked mole-rat(101718722) ADAM metallopeptidase domain 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014661 MISSION® esiRNA esiRNA targeting human ADAM18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014237 Rosetta Predictions human pricing
XM_001072121 Rosetta Predictions rat pricing
XM_341456 Rosetta Predictions rat pricing
NM_010084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345276 predicted 694
2 SASI_Hs01_00147212 predicted 1460
3 SASI_Hs01_00147213 predicted 454
4 SASI_Hs02_00345277 predicted 767
5 SASI_Hs01_00147214 predicted 879
6 SASI_Hs01_00147215 predicted 1606
7 SASI_Hs01_00147216 predicted 370
8 SASI_Hs01_00147217 predicted 288
9 SASI_Hs01_00147218 predicted 1018
10 SASI_Hs01_00147219 predicted 1353
11 SASI_Hs01_00147220 predicted 1864
12 SASI_Hs01_00147221 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337908 predicted 614
2 SASI_Rn02_00337909 predicted 363
3 SASI_Rn02_00337910 predicted 1828
4 SASI_Rn02_00337911 predicted 1053
5 SASI_Rn02_00337912 predicted 1167
6 SASI_Rn02_00337913 predicted 1635
7 SASI_Rn02_00337914 predicted 756
8 SASI_Rn02_00337915 predicted 589
9 SASI_Rn02_00337916 predicted 542
10 SASI_Rn02_00337917 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392952 predicted 653
2 SASI_Rn02_00392953 predicted 721
3 SASI_Rn02_00392954 predicted 393
4 SASI_Rn02_00392955 predicted 473
5 SASI_Rn02_00392956 predicted 492
6 SASI_Rn02_00392957 predicted 426
7 SASI_Rn02_00392958 predicted 297
8 SASI_Rn02_00392959 predicted 619
9 SASI_Rn02_00392960 predicted 577
10 SASI_Rn02_00392961 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153129 predicted 1899
2 SASI_Mm01_00153130 predicted 674
3 SASI_Mm01_00153131 predicted 731
4 SASI_Mm02_00317775 predicted 652
5 SASI_Mm01_00153132 predicted 1636
6 SASI_Mm01_00153133 predicted 628
7 SASI_Mm02_00317776 predicted 986
8 SASI_Mm01_00153134 predicted 855
9 SASI_Mm01_00153135 predicted 1738
10 SASI_Mm01_00153136 predicted 446
11 SASI_Mm01_00153137 predicted 1018
12 SASI_Mm01_00153138 predicted 1780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014237
ADAM18 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 18
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014237.1-283s21c1
Sequence:CCGGCAAGGATATGCTGCCGAATTTCTCGAGAAATTCGGCAGCATATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014237.1-399s21c1
Sequence:CCGGAGCAAGATTTGAGCATATAATCTCGAGATTATATGCTCAAATCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-965s1c1
Sequence:CCGGGCCTTAATGTAGGATTAACATCTCGAGATGTTAATCCTACATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-1654s1c1
Sequence:CCGGGCTTGTGTTCAGCCACATAAACTCGAGTTTATGTGGCTGAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-48s1c1
Sequence:CCGGCCACGAAGGTTCTGAAGGAATCTCGAGATTCCTTCAGAACCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-1463s1c1
Sequence:CCGGCCTATTGCTATAACGGACAATCTCGAGATTGTCCGTTATAGCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-492s1c1
Sequence:CCGGCCAGCCCTACAAAGTTCCTTTCTCGAGAAAGGAACTTTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014237
ADAM18 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 18
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014237.1-283s21c1
Sequence:CCGGCAAGGATATGCTGCCGAATTTCTCGAGAAATTCGGCAGCATATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014237.1-399s21c1
Sequence:CCGGAGCAAGATTTGAGCATATAATCTCGAGATTATATGCTCAAATCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-965s1c1
Sequence:CCGGGCCTTAATGTAGGATTAACATCTCGAGATGTTAATCCTACATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-1654s1c1
Sequence:CCGGGCTTGTGTTCAGCCACATAAACTCGAGTTTATGTGGCTGAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-48s1c1
Sequence:CCGGCCACGAAGGTTCTGAAGGAATCTCGAGATTCCTTCAGAACCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-1463s1c1
Sequence:CCGGCCTATTGCTATAACGGACAATCTCGAGATTGTCCGTTATAGCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-492s1c1
Sequence:CCGGCCAGCCCTACAAAGTTCCTTTCTCGAGAAAGGAACTTTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014237
ADAM18 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 18
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014237.1-283s21c1
Sequence:CCGGCAAGGATATGCTGCCGAATTTCTCGAGAAATTCGGCAGCATATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014237.1-399s21c1
Sequence:CCGGAGCAAGATTTGAGCATATAATCTCGAGATTATATGCTCAAATCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-965s1c1
Sequence:CCGGGCCTTAATGTAGGATTAACATCTCGAGATGTTAATCCTACATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-1654s1c1
Sequence:CCGGGCTTGTGTTCAGCCACATAAACTCGAGTTTATGTGGCTGAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-48s1c1
Sequence:CCGGCCACGAAGGTTCTGAAGGAATCTCGAGATTCCTTCAGAACCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-1463s1c1
Sequence:CCGGCCTATTGCTATAACGGACAATCTCGAGATTGTCCGTTATAGCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014237.1-492s1c1
Sequence:CCGGCCAGCCCTACAAAGTTCCTTTCTCGAGAAAGGAACTTTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010084
ADAM18 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-908s1c1
Sequence:CCGGGCCAGGTGAAATATGCAGTAACTCGAGTTACTGCATATTTCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1995s1c1
Sequence:CCGGCCAGATTGTAACTTACAGATTCTCGAGAATCTGTAAGTTACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1733s1c1
Sequence:CCGGCCCTAGTCAATCTGTGGTCTACTCGAGTAGACCACAGATTGACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-453s1c1
Sequence:CCGGGCAAGGTTTGAGCACATAGTTCTCGAGAACTATGTGCTCAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1009s1c1
Sequence:CCGGGCCTTCACATAGGATTAACATCTCGAGATGTTAATCCTATGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010084
ADAM18 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-908s1c1
Sequence:CCGGGCCAGGTGAAATATGCAGTAACTCGAGTTACTGCATATTTCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1995s1c1
Sequence:CCGGCCAGATTGTAACTTACAGATTCTCGAGAATCTGTAAGTTACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1733s1c1
Sequence:CCGGCCCTAGTCAATCTGTGGTCTACTCGAGTAGACCACAGATTGACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-453s1c1
Sequence:CCGGGCAAGGTTTGAGCACATAGTTCTCGAGAACTATGTGCTCAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1009s1c1
Sequence:CCGGGCCTTCACATAGGATTAACATCTCGAGATGTTAATCCTATGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010084
ADAM18 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-908s1c1
Sequence:CCGGGCCAGGTGAAATATGCAGTAACTCGAGTTACTGCATATTTCACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1995s1c1
Sequence:CCGGCCAGATTGTAACTTACAGATTCTCGAGAATCTGTAAGTTACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1733s1c1
Sequence:CCGGCCCTAGTCAATCTGTGGTCTACTCGAGTAGACCACAGATTGACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-453s1c1
Sequence:CCGGGCAAGGTTTGAGCACATAGTTCTCGAGAACTATGTGCTCAAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010084.1-1009s1c1
Sequence:CCGGGCCTTCACATAGGATTAACATCTCGAGATGTTAATCCTATGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks