EMAIL THIS PAGE TO A FRIEND

ADAM19

ADAM metallopeptidase domain 19

201 Gene Product Result for
Synonyms: MADDAM MLTNB
UniProtKB ID: Q9H013, Q9BZL5, Q9UHP2
Gene ID:
Human(8728) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This member is a type I transmembrane protein and serves as a marker for dendritic cell differentiation. It has been demonstrated to be an active metalloproteinase, which may be involved in normal physiological processes such as cell migration, cell adhesion, cell-cell and cell-matrix interactions, and signal transduction. It is proposed to play a role in pathological processes, such as cancer, inflammatory diseases, renal diseases, and Alzheimer's disease. [provided by RefSeq, May 2013]
Mouse(11492) a disintegrin and metallopeptidase domain 19 (meltrin beta)
Rat(303068) ADAM metallopeptidase domain 19
naked mole-rat(101707880) ADAM metallopeptidase domain 19
domestic guinea pig(100731212) ADAM metallopeptidase domain 19
sheep(101113590) ADAM metallopeptidase domain 19
Domestic Rabbit(100352746) ADAM metallopeptidase domain 19
chicken(416244) ADAM metallopeptidase domain 19
dog(489156) ADAM metallopeptidase domain 19
domestic cat(101090741) ADAM metallopeptidase domain 19
Horse(100059871) ADAM metallopeptidase domain 19
cow(510907) ADAM metallopeptidase domain 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023038 Rosetta Predictions human pricing
NM_033274 Rosetta Predictions human pricing
XM_001069002 Rosetta Predictions rat pricing
XM_220328 Rosetta Predictions rat pricing
NM_009616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151472 predicted 698
2 SASI_Hs01_00151473 predicted 773
3 SASI_Hs02_00356301 predicted 697
4 SASI_Hs01_00151475 predicted 1832
5 SASI_Hs01_00151477 predicted 365
6 SASI_Hs01_00151478 predicted 954
7 SASI_Hs01_00151479 predicted 1948
8 SASI_Hs02_00356302 predicted 874
9 SASI_Hs01_00151480 predicted 465
10 SASI_Hs02_00356303 predicted 1387
11 SASI_Hs01_00151474 predicted 952
12 SASI_Hs01_00151476 predicted 1970
13 SASI_Hs01_00151481 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096484 predicted 699
2 SASI_Hs01_00096485 predicted 774
3 SASI_Hs02_00361077 predicted 701
4 SASI_Hs01_00096487 predicted 1828
5 SASI_Hs01_00096489 predicted 364
6 SASI_Hs01_00096490 predicted 951
7 SASI_Hs01_00096491 predicted 1948
8 SASI_Hs02_00361078 predicted 868
9 SASI_Hs01_00096492 predicted 459
10 SASI_Hs02_00361079 predicted 1385
11 SASI_Hs01_00096486 predicted 943
12 SASI_Hs01_00096488 predicted 1960
13 SASI_Hs01_00096493 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326567 predicted 521
2 SASI_Rn02_00326568 predicted 1415
3 SASI_Rn02_00326569 predicted 540
4 SASI_Rn02_00326570 predicted 1014
5 SASI_Rn02_00326571 predicted 1661
6 SASI_Rn02_00326572 predicted 2276
7 SASI_Rn02_00326573 predicted 771
8 SASI_Rn02_00326574 predicted 762
9 SASI_Rn02_00326575 predicted 754
10 SASI_Rn02_00326576 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379235 predicted 2407
2 SASI_Rn02_00379236 predicted 2018
3 SASI_Rn02_00379237 predicted 1413
4 SASI_Rn02_00379238 predicted 1013
5 SASI_Rn02_00379239 predicted 1662
6 SASI_Rn02_00379240 predicted 2285
7 SASI_Rn02_00379241 predicted 768
8 SASI_Rn02_00379242 predicted 755
9 SASI_Rn02_00379243 predicted 1347
10 SASI_Rn02_00379244 predicted 1875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185324 predicted 604
2 SASI_Mm02_00316555 predicted 689
3 SASI_Mm01_00185326 predicted 525
4 SASI_Mm01_00185327 predicted 553
5 SASI_Mm02_00316556 predicted 728
6 SASI_Mm01_00185328 predicted 781
7 SASI_Mm01_00185330 predicted 1425
8 SASI_Mm02_00316557 predicted 1883
9 SASI_Mm01_00185331 predicted 1005
10 SASI_Mm02_00316558 predicted 1269
11 SASI_Mm01_00185325 predicted 2820
12 SASI_Mm01_00185329 predicted 1213
13 SASI_Mm01_00185332 predicted 963
14 SASI_Mm01_00185333 predicted 2163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023038
VALIDATED
ADAM19 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023038.2-444s1c1
Sequence:CCGGCCGAGGAATTAGAGGACTGATCTCGAGATCAGTCCTCTAATTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023038.2-1370s1c1
Sequence:CCGGCCTGCTGCAATGCCTCTAATTCTCGAGAATTAGAGGCATTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-2573s1c1
Sequence:CCGGCCGCACCAAATTGCATCGTTTCTCGAGAAACGATGCAATTTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-1530s1c1
Sequence:CCGGCCCTACCAACTTCTACCAGATCTCGAGATCTGGTAGAAGTTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-330s1c1
Sequence:CCGGCCATTATACTTCAAGTGGTAACTCGAGTTACCACTTGAAGTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023038
VALIDATED
ADAM19 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023038.2-444s1c1
Sequence:CCGGCCGAGGAATTAGAGGACTGATCTCGAGATCAGTCCTCTAATTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023038.2-1370s1c1
Sequence:CCGGCCTGCTGCAATGCCTCTAATTCTCGAGAATTAGAGGCATTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-2573s1c1
Sequence:CCGGCCGCACCAAATTGCATCGTTTCTCGAGAAACGATGCAATTTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-1530s1c1
Sequence:CCGGCCCTACCAACTTCTACCAGATCTCGAGATCTGGTAGAAGTTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-330s1c1
Sequence:CCGGCCATTATACTTCAAGTGGTAACTCGAGTTACCACTTGAAGTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023038
VALIDATED
ADAM19 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023038.2-444s1c1
Sequence:CCGGCCGAGGAATTAGAGGACTGATCTCGAGATCAGTCCTCTAATTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023038.2-1370s1c1
Sequence:CCGGCCTGCTGCAATGCCTCTAATTCTCGAGAATTAGAGGCATTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-2573s1c1
Sequence:CCGGCCGCACCAAATTGCATCGTTTCTCGAGAAACGATGCAATTTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-1530s1c1
Sequence:CCGGCCCTACCAACTTCTACCAGATCTCGAGATCTGGTAGAAGTTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_023038.2-330s1c1
Sequence:CCGGCCATTATACTTCAAGTGGTAACTCGAGTTACCACTTGAAGTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009616
VALIDATED
ADAM19 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009616.2-3899s1c1
Sequence:CCGGCCTCCTTATTTCTGACTCATACTCGAGTATGAGTCAGAAATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-660s1c1
Sequence:CCGGCGCAGAATGAAACGGGAAGATCTCGAGATCTTCCCGTTTCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-2297s1c1
Sequence:CCGGGCATCAGTTCAGTTGTCCCTTCTCGAGAAGGGACAACTGAACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-946s1c1
Sequence:CCGGGCCATGACAATGCTCAGCTAACTCGAGTTAGCTGAGCATTGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-184s1c1
Sequence:CCGGCGCTACAGCATGAACTCATAACTCGAGTTATGAGTTCATGCTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-2032s21c1
Sequence:CCGGGTGTGGCCACAACCATATTTGCTCGAGCAAATATGGTTGTGGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-530s21c1
Sequence:CCGGGGAATTAGAGGACTGATTATACTCGAGTATAATCAGTCCTCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-1886s21c1
Sequence:CCGGGAATCCAACGCAGTATCTATTCTCGAGAATAGATACTGCGTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-594s21c1
Sequence:CCGGGCGACAGCCAACACCGTATTTCTCGAGAAATACGGTGTTGGCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009616
VALIDATED
ADAM19 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009616.2-3899s1c1
Sequence:CCGGCCTCCTTATTTCTGACTCATACTCGAGTATGAGTCAGAAATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-660s1c1
Sequence:CCGGCGCAGAATGAAACGGGAAGATCTCGAGATCTTCCCGTTTCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-2297s1c1
Sequence:CCGGGCATCAGTTCAGTTGTCCCTTCTCGAGAAGGGACAACTGAACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-946s1c1
Sequence:CCGGGCCATGACAATGCTCAGCTAACTCGAGTTAGCTGAGCATTGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-184s1c1
Sequence:CCGGCGCTACAGCATGAACTCATAACTCGAGTTATGAGTTCATGCTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-2032s21c1
Sequence:CCGGGTGTGGCCACAACCATATTTGCTCGAGCAAATATGGTTGTGGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-530s21c1
Sequence:CCGGGGAATTAGAGGACTGATTATACTCGAGTATAATCAGTCCTCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-1886s21c1
Sequence:CCGGGAATCCAACGCAGTATCTATTCTCGAGAATAGATACTGCGTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-594s21c1
Sequence:CCGGGCGACAGCCAACACCGTATTTCTCGAGAAATACGGTGTTGGCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009616
VALIDATED
ADAM19 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009616.2-3899s1c1
Sequence:CCGGCCTCCTTATTTCTGACTCATACTCGAGTATGAGTCAGAAATAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-660s1c1
Sequence:CCGGCGCAGAATGAAACGGGAAGATCTCGAGATCTTCCCGTTTCATTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-2297s1c1
Sequence:CCGGGCATCAGTTCAGTTGTCCCTTCTCGAGAAGGGACAACTGAACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-946s1c1
Sequence:CCGGGCCATGACAATGCTCAGCTAACTCGAGTTAGCTGAGCATTGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009616.2-184s1c1
Sequence:CCGGCGCTACAGCATGAACTCATAACTCGAGTTATGAGTTCATGCTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-2032s21c1
Sequence:CCGGGTGTGGCCACAACCATATTTGCTCGAGCAAATATGGTTGTGGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-530s21c1
Sequence:CCGGGGAATTAGAGGACTGATTATACTCGAGTATAATCAGTCCTCTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-1886s21c1
Sequence:CCGGGAATCCAACGCAGTATCTATTCTCGAGAATAGATACTGCGTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009616.3-594s21c1
Sequence:CCGGGCGACAGCCAACACCGTATTTCTCGAGAAATACGGTGTTGGCTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks