EMAIL THIS PAGE TO A FRIEND

ADAM1A

ADAM metallopeptidase domain 1A, pseudogene

39 Gene Product Result for
Synonyms: ADAM1 ADAM1P FTNAP Ftna PH-30a
Gene ID:
Mouse(280668) a disintegrin and metallopeptidase domain 1a
Rat(56777) a disintegrin and metallopeptidase domain 1a
cow(783232) a disintegrin and metallopeptidase domain 1a
Domestic Rabbit(100009435) fertilin alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU030111 MISSION® esiRNA esiRNA targeting mouse Adam1a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020078 Rosetta Predictions rat pricing
XM_579441 Rosetta Predictions rat pricing
NM_172126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079236 predicted 1645
2 SASI_Rn01_00079237 predicted 1997
3 SASI_Rn01_00079238 predicted 2255
4 SASI_Rn01_00079239 predicted 2506
5 SASI_Rn01_00079240 predicted 1856
6 SASI_Rn01_00079241 predicted 582
7 SASI_Rn01_00079242 predicted 1921
8 SASI_Rn02_00262481 predicted 952
9 SASI_Rn01_00079243 predicted 1857
10 SASI_Rn01_00079244 predicted 2235
11 SASI_Rn01_00079245 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00138101 predicted 2534
2 SASI_Rn01_00138102 predicted 2519
3 SASI_Rn01_00138103 predicted 2392
4 SASI_Rn01_00138104 predicted 2296
5 SASI_Rn01_00138105 predicted 2624
6 SASI_Rn01_00138106 predicted 2360
7 SASI_Rn01_00138107 predicted 2445
8 SASI_Rn01_00138108 predicted 2433
9 SASI_Rn01_00138109 predicted 2283
10 SASI_Rn01_00138110 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114562 predicted 2468
2 SASI_Mm01_00114563 predicted 1974
3 SASI_Mm01_00114564 predicted 1870
4 SASI_Mm01_00114565 predicted 2767
5 SASI_Mm01_00114566 predicted 2065
6 SASI_Mm01_00114567 predicted 2271
7 SASI_Mm01_00114568 predicted 2339
8 SASI_Mm01_00114569 predicted 813
9 SASI_Mm01_00114570 predicted 2491
10 SASI_Mm02_00343664 predicted 2865
11 SASI_Mm01_00114561 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172126
ADAM1A MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 1A, pseudogene
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-1968s21c1
Sequence:CCGGTGTGACCTTCCCGAGTATTGTCTCGAGACAATACTCGGGAAGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-2132s21c1
Sequence:CCCGCCCTGAGGAATGTTACATTTCCTCGAGGAAATGTAACATTCCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-2098s21c1
Sequence:CCGGGTTCAAGGATCTATGGGTATCCTCGAGGATACCCATAGATCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-1859s21c1
Sequence:CCGGTTCGCCAACATGTACGCTTAACTCGAGTTAAGCGTACATGTTGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172126.2-2859s1c1
Sequence:CCGGCCTCTCATGGATCATTGCTATCTCGAGATAGCAATGATCCATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2035s1c1
Sequence:CCGGGCACACAGTGTGATAGGATTTCTCGAGAAATCCTATCACACTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2761s1c1
Sequence:CCGGCTGAAGTACAAGAAGTAGTATCTCGAGATACTACTTCTTGTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-545s1c1
Sequence:CCGGAGCTAAGCTAACACCTCACATCTCGAGATGTGAGGTGTTAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2200s1c1
Sequence:CCGGCCGCTAACTTCAGATATGAAACTCGAGTTTCATATCTGAAGTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172126
ADAM1A MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 1A, pseudogene
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-1968s21c1
Sequence:CCGGTGTGACCTTCCCGAGTATTGTCTCGAGACAATACTCGGGAAGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-2132s21c1
Sequence:CCCGCCCTGAGGAATGTTACATTTCCTCGAGGAAATGTAACATTCCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-2098s21c1
Sequence:CCGGGTTCAAGGATCTATGGGTATCCTCGAGGATACCCATAGATCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-1859s21c1
Sequence:CCGGTTCGCCAACATGTACGCTTAACTCGAGTTAAGCGTACATGTTGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172126.2-2859s1c1
Sequence:CCGGCCTCTCATGGATCATTGCTATCTCGAGATAGCAATGATCCATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2035s1c1
Sequence:CCGGGCACACAGTGTGATAGGATTTCTCGAGAAATCCTATCACACTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2761s1c1
Sequence:CCGGCTGAAGTACAAGAAGTAGTATCTCGAGATACTACTTCTTGTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-545s1c1
Sequence:CCGGAGCTAAGCTAACACCTCACATCTCGAGATGTGAGGTGTTAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2200s1c1
Sequence:CCGGCCGCTAACTTCAGATATGAAACTCGAGTTTCATATCTGAAGTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172126
ADAM1A MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 1A, pseudogene
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-1968s21c1
Sequence:CCGGTGTGACCTTCCCGAGTATTGTCTCGAGACAATACTCGGGAAGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-2132s21c1
Sequence:CCCGCCCTGAGGAATGTTACATTTCCTCGAGGAAATGTAACATTCCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-2098s21c1
Sequence:CCGGGTTCAAGGATCTATGGGTATCCTCGAGGATACCCATAGATCCTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172126.2-1859s21c1
Sequence:CCGGTTCGCCAACATGTACGCTTAACTCGAGTTAAGCGTACATGTTGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172126.2-2859s1c1
Sequence:CCGGCCTCTCATGGATCATTGCTATCTCGAGATAGCAATGATCCATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2035s1c1
Sequence:CCGGGCACACAGTGTGATAGGATTTCTCGAGAAATCCTATCACACTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2761s1c1
Sequence:CCGGCTGAAGTACAAGAAGTAGTATCTCGAGATACTACTTCTTGTACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-545s1c1
Sequence:CCGGAGCTAAGCTAACACCTCACATCTCGAGATGTGAGGTGTTAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172126.2-2200s1c1
Sequence:CCGGCCGCTAACTTCAGATATGAAACTCGAGTTTCATATCTGAAGTTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks