EMAIL THIS PAGE TO A FRIEND

ADAM1B

ADAM metallopeptidase domain 1B, pseudogene

14 Gene Product Result for
Gene ID:
Mouse(280667) a disintegrin and metallopeptidase domain 1b
cow(286843) a disintegrin and metallopeptidase domain 1b
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003451 MISSION® esiRNA esiRNA targeting mouse Adam1b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065658 predicted 408
2 SASI_Mm01_00065659 predicted 401
3 SASI_Mm01_00065660 predicted 1525
4 SASI_Mm01_00065661 predicted 615
5 SASI_Mm01_00065662 predicted 917
6 SASI_Mm01_00065663 predicted 252
7 SASI_Mm01_00065664 predicted 1843
8 SASI_Mm01_00065665 predicted 1485
9 SASI_Mm02_00343663 predicted 1492
10 SASI_Mm01_00065667 predicted 1085
11 SASI_Mm01_00065666 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172125
ADAM1B MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 1B, pseudogene
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000031754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-2028s1c1
Sequence:CCGGCCCTGCTGTTAATCTGTCAAACTCGAGTTTGACAGATTAACAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-55s1c1
Sequence:CCGGGCCATGTTGCTCTTGGCAATACTCGAGTATTGCCAAGAGCAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-1716s1c1
Sequence:CCGGGCCACAAATCCAACCGAACAACTCGAGTTGTTCGGTTGGATTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-1783s1c1
Sequence:CCGGGCTGTGTTTGACATGAGAGATCTCGAGATCTCTCATGTCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172125
ADAM1B MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 1B, pseudogene
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000031754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-2028s1c1
Sequence:CCGGCCCTGCTGTTAATCTGTCAAACTCGAGTTTGACAGATTAACAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-55s1c1
Sequence:CCGGGCCATGTTGCTCTTGGCAATACTCGAGTATTGCCAAGAGCAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-1716s1c1
Sequence:CCGGGCCACAAATCCAACCGAACAACTCGAGTTGTTCGGTTGGATTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-1783s1c1
Sequence:CCGGGCTGTGTTTGACATGAGAGATCTCGAGATCTCTCATGTCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172125
ADAM1B MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 1B, pseudogene
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000031754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-2028s1c1
Sequence:CCGGCCCTGCTGTTAATCTGTCAAACTCGAGTTTGACAGATTAACAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-55s1c1
Sequence:CCGGGCCATGTTGCTCTTGGCAATACTCGAGTATTGCCAAGAGCAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-1716s1c1
Sequence:CCGGGCCACAAATCCAACCGAACAACTCGAGTTGTTCGGTTGGATTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172125.1-1783s1c1
Sequence:CCGGGCTGTGTTTGACATGAGAGATCTCGAGATCTCTCATGTCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks