EMAIL THIS PAGE TO A FRIEND

ADAM20

ADAM metallopeptidase domain 20

66 Gene Product Result for
UniProtKB ID: O43506, Q6GTZ1, Q9UKJ9
Gene ID:
Human(8748) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The expression of this gene is testis-specific. [provided by RefSeq, Jul 2008]
Mouse(384806) a disintegrin and metallopeptidase domain 20
Rat(290726) ADAM metallopeptidase domain 20
sheep(101102399) ADAM metallopeptidase domain 20
Domestic Rabbit(100343004) ADAM metallopeptidase domain 20
chicken(404294) ADAM metallopeptidase domain 20
cow(782699) ADAM metallopeptidase domain 20
Horse(100146845) ADAM metallopeptidase domain 20
domestic cat(101084205) ADAM metallopeptidase domain 20
dog(486076) ADAM metallopeptidase domain 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_357873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_357873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_357873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004621 MISSION® esiRNA esiRNA targeting human ADAM20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003814 Rosetta Predictions human pricing
XM_001056657 Rosetta Predictions rat pricing
XM_224829 Rosetta Predictions rat pricing
NM_001009548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188960 predicted 866
2 SASI_Hs01_00188961 predicted 509
3 SASI_Hs01_00188962 predicted 2190
4 SASI_Hs02_00336353 predicted 1880
5 SASI_Hs01_00188965 predicted 886
6 SASI_Hs02_00336354 predicted 1292
7 SASI_Hs01_00188967 predicted 1584
8 SASI_Hs01_00188969 predicted 1911
9 SASI_Hs02_00336355 predicted 1311
10 SASI_Hs02_00336356 predicted 2256
11 SASI_Hs01_00188963 predicted 2032
12 SASI_Hs01_00188964 predicted 877
13 SASI_Hs01_00188966 predicted 953
14 SASI_Hs01_00188968 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283961 predicted 692
2 SASI_Rn02_00283962 predicted 989
3 SASI_Rn02_00283963 predicted 533
4 SASI_Rn02_00283964 predicted 841
5 SASI_Rn02_00283965 predicted 706
6 SASI_Rn02_00283966 predicted 597
7 SASI_Rn02_00283967 predicted 360
8 SASI_Rn02_00283968 predicted 1114
9 SASI_Rn02_00283969 predicted 2063
10 SASI_Rn02_00283970 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382286 predicted 699
2 SASI_Rn02_00382287 predicted 990
3 SASI_Rn02_00382288 predicted 539
4 SASI_Rn02_00382289 predicted 843
5 SASI_Rn02_00382290 predicted 707
6 SASI_Rn02_00382291 predicted 604
7 SASI_Rn02_00382292 predicted 366
8 SASI_Rn02_00382293 predicted 1113
9 SASI_Rn02_00382294 predicted 2059
10 SASI_Rn02_00382295 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173825 predicted 1098
2 SASI_Mm01_00173826 predicted 1078
3 SASI_Mm02_00286855 predicted 2073
4 SASI_Mm01_00173827 predicted 1150
5 SASI_Mm02_00286856 predicted 2226
6 SASI_Mm01_00173829 predicted 860
7 SASI_Mm01_00173830 predicted 1436
8 SASI_Mm01_00173831 predicted 1406
9 SASI_Mm01_00173832 predicted 980
10 SASI_Mm01_00173834 predicted 1354
11 SASI_Mm01_00173828 predicted 1126
12 SASI_Mm01_00173833 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003814
ADAM20 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 20
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000051074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-1207s1c1
Sequence:CCGGGCTTGGTCATAATTTGGGTATCTCGAGATACCCAAATTATGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-1369s1c1
Sequence:CCGGGCCTCCATATCCAGGGAATATCTCGAGATATTCCCTGGATATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-857s1c1
Sequence:CCGGGCAACAACAGTGCAGCATGAACTCGAGTTCATGCTGCACTGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-2207s1c1
Sequence:CCGGCCTCCTAAGAACAACATGGAACTCGAGTTCCATGTTGTTCTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003814
ADAM20 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 20
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000051074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-1207s1c1
Sequence:CCGGGCTTGGTCATAATTTGGGTATCTCGAGATACCCAAATTATGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-1369s1c1
Sequence:CCGGGCCTCCATATCCAGGGAATATCTCGAGATATTCCCTGGATATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-857s1c1
Sequence:CCGGGCAACAACAGTGCAGCATGAACTCGAGTTCATGCTGCACTGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-2207s1c1
Sequence:CCGGCCTCCTAAGAACAACATGGAACTCGAGTTCCATGTTGTTCTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003814
ADAM20 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 20
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000051074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-1207s1c1
Sequence:CCGGGCTTGGTCATAATTTGGGTATCTCGAGATACCCAAATTATGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-1369s1c1
Sequence:CCGGGCCTCCATATCCAGGGAATATCTCGAGATATTCCCTGGATATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-857s1c1
Sequence:CCGGGCAACAACAGTGCAGCATGAACTCGAGTTCATGCTGCACTGTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003814.3-2207s1c1
Sequence:CCGGCCTCCTAAGAACAACATGGAACTCGAGTTCCATGTTGTTCTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_357873
ADAM20 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-2244s1c1
Sequence:CCGGCTGGTACTGATTACTCCAATTCTCGAGAATTGGAGTAATCAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-1025s1c1
Sequence:CCGGGAAGACTCTCAGCCTTAATATCTCGAGATATTAAGGCTGAGAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-1159s1c1
Sequence:CCGGGTCTGTTAGGTCCTAATCTTTCTCGAGAAAGATTAGGACCTAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-954s1c1
Sequence:CCGGGAGTTGTGGAATGAAGGAAATCTCGAGATTTCCTTCATTCCACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-980s1c1
Sequence:CCGGGCCCGTGGATAGAATGCAAATCTCGAGATTTGCATTCTATCCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_357873
ADAM20 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-2244s1c1
Sequence:CCGGCTGGTACTGATTACTCCAATTCTCGAGAATTGGAGTAATCAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-1025s1c1
Sequence:CCGGGAAGACTCTCAGCCTTAATATCTCGAGATATTAAGGCTGAGAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-1159s1c1
Sequence:CCGGGTCTGTTAGGTCCTAATCTTTCTCGAGAAAGATTAGGACCTAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-954s1c1
Sequence:CCGGGAGTTGTGGAATGAAGGAAATCTCGAGATTTCCTTCATTCCACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-980s1c1
Sequence:CCGGGCCCGTGGATAGAATGCAAATCTCGAGATTTGCATTCTATCCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_357873
ADAM20 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-2244s1c1
Sequence:CCGGCTGGTACTGATTACTCCAATTCTCGAGAATTGGAGTAATCAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-1025s1c1
Sequence:CCGGGAAGACTCTCAGCCTTAATATCTCGAGATATTAAGGCTGAGAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-1159s1c1
Sequence:CCGGGTCTGTTAGGTCCTAATCTTTCTCGAGAAAGATTAGGACCTAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-954s1c1
Sequence:CCGGGAGTTGTGGAATGAAGGAAATCTCGAGATTTCCTTCATTCCACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357873.2-980s1c1
Sequence:CCGGGCCCGTGGATAGAATGCAAATCTCGAGATTTGCATTCTATCCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks