EMAIL THIS PAGE TO A FRIEND

ADAM21

ADAM metallopeptidase domain 21

41 Gene Product Result for
Synonyms: ADAM 21 ADAM31
UniProtKB ID: Q9UKJ8, O43507, Q2VPC6, Q32MR0
Gene ID:
Human(8747) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The expression of this gene expression is testis-specific. [provided by RefSeq, May 2011]
Mouse(56622) a disintegrin and metallopeptidase domain 21
Rat(314283) a disintegrin and metalloprotease domain 21
cow(789032) ADAM metallopeptidase domain 21
cow(532366) ADAM metallopeptidase domain 21
domestic cat(101082414) ADAM metallopeptidase domain 21
dog(480377) ADAM metallopeptidase domain 21
domestic guinea pig(100715048) ADAM metallopeptidase domain 21
sheep(101101897) ADAM metallopeptidase domain 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057511 MISSION® esiRNA esiRNA human ADAM21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003813 Rosetta Predictions human pricing
NM_020330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134250 predicted 1078
2 SASI_Hs01_00134251 predicted 1839
3 SASI_Hs01_00134252 predicted 1122
4 SASI_Hs01_00134253 predicted 853
5 SASI_Hs01_00134254 predicted 2182
6 SASI_Hs01_00134256 predicted 572
7 SASI_Hs01_00134257 predicted 909
8 SASI_Hs02_00336351 predicted 1792
9 SASI_Hs01_00134258 predicted 1156
10 SASI_Hs02_00336352 predicted 1117
11 SASI_Hs01_00134255 predicted 1235
12 SASI_Hs01_00134259 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088256 predicted 841
2 SASI_Mm01_00088257 predicted 1035
3 SASI_Mm01_00088258 predicted 2612
4 SASI_Mm02_00325525 predicted 2504
5 SASI_Mm01_00088259 predicted 706
6 SASI_Mm01_00088262 predicted 941
7 SASI_Mm01_00088263 predicted 1215
8 SASI_Mm01_00088264 predicted 958
9 SASI_Mm01_00088265 predicted 1323
10 SASI_Mm02_00325526 predicted 1473
11 SASI_Mm01_00088260 predicted 1476
12 SASI_Mm01_00088261 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003813
ADAM21 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 21
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-619s1c1
Sequence:CCGGGCATGGTTTCTGGAGCTAGTTCTCGAGAACTAGCTCCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-206s1c1
Sequence:CCGGGCCAGAAACACGTTGTTCATACTCGAGTATGAACAACGTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-2054s1c1
Sequence:CCGGCGCTGATTGTGATTCCTTCTTCTCGAGAAGAAGGAATCACAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-1902s1c1
Sequence:CCGGCCTTCCTGAGACCTGCAATATCTCGAGATATTGCAGGTCTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-541s1c1
Sequence:CCGGGCACGCCAACAGTTGGAATTTCTCGAGAAATTCCAACTGTTGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003813.2-817s21c1
Sequence:CCGGGAACAGGTCCTGAACGATTTCCTCGAGGAAATCGTTCAGGACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003813.2-1302s21c1
Sequence:CCGGTCTGTTGAACTGCACTCTAAGCTCGAGCTTAGAGTGCAGTTCAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003813
ADAM21 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 21
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-619s1c1
Sequence:CCGGGCATGGTTTCTGGAGCTAGTTCTCGAGAACTAGCTCCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-206s1c1
Sequence:CCGGGCCAGAAACACGTTGTTCATACTCGAGTATGAACAACGTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-2054s1c1
Sequence:CCGGCGCTGATTGTGATTCCTTCTTCTCGAGAAGAAGGAATCACAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-1902s1c1
Sequence:CCGGCCTTCCTGAGACCTGCAATATCTCGAGATATTGCAGGTCTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-541s1c1
Sequence:CCGGGCACGCCAACAGTTGGAATTTCTCGAGAAATTCCAACTGTTGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003813.2-817s21c1
Sequence:CCGGGAACAGGTCCTGAACGATTTCCTCGAGGAAATCGTTCAGGACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003813.2-1302s21c1
Sequence:CCGGTCTGTTGAACTGCACTCTAAGCTCGAGCTTAGAGTGCAGTTCAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003813
ADAM21 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 21
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-619s1c1
Sequence:CCGGGCATGGTTTCTGGAGCTAGTTCTCGAGAACTAGCTCCAGAAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-206s1c1
Sequence:CCGGGCCAGAAACACGTTGTTCATACTCGAGTATGAACAACGTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-2054s1c1
Sequence:CCGGCGCTGATTGTGATTCCTTCTTCTCGAGAAGAAGGAATCACAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-1902s1c1
Sequence:CCGGCCTTCCTGAGACCTGCAATATCTCGAGATATTGCAGGTCTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003813.2-541s1c1
Sequence:CCGGGCACGCCAACAGTTGGAATTTCTCGAGAAATTCCAACTGTTGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003813.2-817s21c1
Sequence:CCGGGAACAGGTCCTGAACGATTTCCTCGAGGAAATCGTTCAGGACCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003813.2-1302s21c1
Sequence:CCGGTCTGTTGAACTGCACTCTAAGCTCGAGCTTAGAGTGCAGTTCAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020330
ADAM21 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1265s1c1
Sequence:CCGGGCTGGATACTTATGTGACTTTCTCGAGAAAGTCACATAAGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1037s1c1
Sequence:CCGGGCTATGTAGTTTAACGGAGAACTCGAGTTCTCCGTTAAACTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1540s1c1
Sequence:CCGGCCCATGAGTTAGGCCATACTTCTCGAGAAGTATGGCCTAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-2093s1c1
Sequence:CCGGCGCATCTCATAATTGCTATAACTCGAGTTATAGCAATTATGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-2628s1c1
Sequence:CCGGGCTGGGCTTTATAGAATATATCTCGAGATATATTCTATAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020330
ADAM21 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1265s1c1
Sequence:CCGGGCTGGATACTTATGTGACTTTCTCGAGAAAGTCACATAAGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1037s1c1
Sequence:CCGGGCTATGTAGTTTAACGGAGAACTCGAGTTCTCCGTTAAACTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1540s1c1
Sequence:CCGGCCCATGAGTTAGGCCATACTTCTCGAGAAGTATGGCCTAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-2093s1c1
Sequence:CCGGCGCATCTCATAATTGCTATAACTCGAGTTATAGCAATTATGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-2628s1c1
Sequence:CCGGGCTGGGCTTTATAGAATATATCTCGAGATATATTCTATAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020330
ADAM21 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1265s1c1
Sequence:CCGGGCTGGATACTTATGTGACTTTCTCGAGAAAGTCACATAAGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1037s1c1
Sequence:CCGGGCTATGTAGTTTAACGGAGAACTCGAGTTCTCCGTTAAACTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-1540s1c1
Sequence:CCGGCCCATGAGTTAGGCCATACTTCTCGAGAAGTATGGCCTAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-2093s1c1
Sequence:CCGGCGCATCTCATAATTGCTATAACTCGAGTTATAGCAATTATGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020330.2-2628s1c1
Sequence:CCGGGCTGGGCTTTATAGAATATATCTCGAGATATATTCTATAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks