EMAIL THIS PAGE TO A FRIEND

ADAM22

ADAM metallopeptidase domain 22

183 Gene Product Result for
Synonyms: ADAM 22 MDC2
UniProtKB ID: Q9P0K1, O75075, O75076, Q9P0K2, Q9UIA1, Q9UKK2
Gene ID:
Human(53616) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. Unlike other members of the ADAM protein family, the protein encoded by this gene lacks metalloprotease activity since it has no zinc-binding motif. This gene is highly expressed in the brain and may function as an integrin ligand in the brain. In mice, it has been shown to be essential for correct myelination in the peripheral nervous system. Alternative splicing results in several transcript variants.[provided by RefSeq, Dec 2010]
Mouse(11496) a disintegrin and metallopeptidase domain 22
Rat(57033) ADAM metallopeptidase domain 22
Zebrafish(100240727) a disintegrin and metallopeptidase domain 22
chicken(420537) ADAM metallopeptidase domain 22
dog(482286) ADAM metallopeptidase domain 22
domestic cat(101098366) ADAM metallopeptidase domain 22
Horse(100050380) ADAM metallopeptidase domain 22
cow(523645) ADAM metallopeptidase domain 22
sheep(101116564) ADAM metallopeptidase domain 22
Domestic Rabbit(100338906) ADAM metallopeptidase domain 22
domestic guinea pig(100727244) ADAM metallopeptidase domain 22
naked mole-rat(101704879) ADAM metallopeptidase domain 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304586 ANTI-ADAM22 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2700537 Anti-ADAM22 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1407532 Anti-ADAM22 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA045282 Anti-ADAM22 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106732 Anti-ADAM22 antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, horse, rabbit
ELISA, western blot pricing
HPA050325 Anti-ADAM22 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB5200564 Monoclonal Anti-Adam22 (Cytoplasmic) antibody produced in mouse clone S46-30, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200582 Monoclonal Anti-Adam22 (Extracellular) antibody produced in mouse clone S57-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200573 Monoclonal Anti-Adam22 - Alkaline Phosphatase antibody produced in mouse clone S46-30, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200591 Monoclonal Anti-Adam22 - Alkaline Phosphatase antibody produced in mouse clone S57-2, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200574 Monoclonal Anti-Adam22 - Apc antibody produced in mouse clone S46-30, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200592 Monoclonal Anti-Adam22 - Apc antibody produced in mouse clone S57-2, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200565 Monoclonal Anti-Adam22 - Atto 390 antibody produced in mouse clone S46-30, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200583 Monoclonal Anti-Adam22 - Atto 390 antibody produced in mouse clone S57-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200566 Monoclonal Anti-Adam22 - Atto 488 antibody produced in mouse clone S46-30, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200584 Monoclonal Anti-Adam22 - Atto 488 antibody produced in mouse clone S57-2, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200567 Monoclonal Anti-Adam22 - Atto 565 antibody produced in mouse clone S46-30, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200585 Monoclonal Anti-Adam22 - Atto 565 antibody produced in mouse clone S57-2, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200568 Monoclonal Anti-Adam22 - Atto 594 antibody produced in mouse clone S46-30, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200586 Monoclonal Anti-Adam22 - Atto 594 antibody produced in mouse clone S57-2, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200569 Monoclonal Anti-Adam22 - Atto 633 antibody produced in mouse clone S46-30, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200587 Monoclonal Anti-Adam22 - Atto 633 antibody produced in mouse clone S57-2, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200570 Monoclonal Anti-Adam22 - Atto 655 antibody produced in mouse clone S46-30, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200588 Monoclonal Anti-Adam22 - Atto 655 antibody produced in mouse clone S57-2, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200571 Monoclonal Anti-Adam22 - Atto 680 antibody produced in mouse clone S46-30, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200589 Monoclonal Anti-Adam22 - Atto 680 antibody produced in mouse clone S57-2, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200572 Monoclonal Anti-Adam22 - Atto 700 antibody produced in mouse clone S46-30, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200590 Monoclonal Anti-Adam22 - Atto 700 antibody produced in mouse clone S57-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200575 Monoclonal Anti-Adam22 - Biotin antibody produced in mouse clone S46-30, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200593 Monoclonal Anti-Adam22 - Biotin antibody produced in mouse clone S57-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200576 Monoclonal Anti-Adam22 - Fitc antibody produced in mouse clone S46-30, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200594 Monoclonal Anti-Adam22 - Fitc antibody produced in mouse clone S57-2, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200577 Monoclonal Anti-Adam22 - Hrp antibody produced in mouse clone S46-30, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200595 Monoclonal Anti-Adam22 - Hrp antibody produced in mouse clone S57-2, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200578 Monoclonal Anti-Adam22 - Pe/Atto 594 antibody produced in mouse clone S46-30, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200596 Monoclonal Anti-Adam22 - Pe/Atto 594 antibody produced in mouse clone S57-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200579 Monoclonal Anti-Adam22 - Percp antibody produced in mouse clone S46-30, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200597 Monoclonal Anti-Adam22 - Percp antibody produced in mouse clone S57-2, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200580 Monoclonal Anti-Adam22 - Rpe antibody produced in mouse clone S46-30, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200598 Monoclonal Anti-Adam22 - Rpe antibody produced in mouse clone S57-2, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200581 Monoclonal Anti-Adam22 - Streptavidin antibody produced in mouse clone S46-30, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200599 Monoclonal Anti-Adam22 - Streptavidin antibody produced in mouse clone S57-2, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunoprecipitation, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1249 Human ADAM-22 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004194 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_131876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004194 Rosetta Predictions human pricing
NM_016351 Rosetta Predictions human pricing
NM_021721 Rosetta Predictions human pricing
NM_021722 Rosetta Predictions human pricing
NM_021723 Rosetta Predictions human pricing
NM_001007220 Rosetta Predictions mouse pricing
NM_001007221 Rosetta Predictions mouse pricing
NM_001098225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026811 predicted 1777
2 SASI_Hs01_00026812 predicted 1103
3 SASI_Hs02_00337089 predicted 1319
4 SASI_Hs02_00337090 predicted 2124
5 SASI_Hs01_00026813 predicted 665
6 SASI_Hs02_00337091 predicted 1964
7 SASI_Hs01_00026814 predicted 852
8 SASI_Hs01_00026815 predicted 1225
9 SASI_Hs01_00026817 predicted 602
10 SASI_Hs01_00026819 predicted 963
11 SASI_Hs01_00026816 predicted 2152
12 SASI_Hs01_00026818 predicted 477
13 SASI_Hs01_00026820 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243205 predicted 1779
2 SASI_Hs01_00243206 predicted 1097
3 SASI_Hs02_00349312 predicted 1318
4 SASI_Hs02_00349313 predicted 2126
5 SASI_Hs01_00243207 predicted 662
6 SASI_Hs01_00243208 predicted 1962
7 SASI_Hs01_00243209 predicted 859
8 SASI_Hs01_00243210 predicted 1232
9 SASI_Hs01_00243212 predicted 605
10 SASI_Hs01_00243214 predicted 956
11 SASI_Hs01_00243211 predicted 2144
12 SASI_Hs01_00243213 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136620 predicted 1777
2 SASI_Hs01_00136621 predicted 1096
3 SASI_Hs02_00355035 predicted 1326
4 SASI_Hs02_00355036 predicted 2124
5 SASI_Hs01_00136622 predicted 665
6 SASI_Hs01_00136623 predicted 1959
7 SASI_Hs01_00136624 predicted 857
8 SASI_Hs01_00136625 predicted 1223
9 SASI_Hs01_00136627 predicted 607
10 SASI_Hs01_00136629 predicted 962
11 SASI_Hs01_00136626 predicted 2150
12 SASI_Hs01_00136628 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024737 predicted 1783
2 SASI_Hs01_00024738 predicted 1095
3 SASI_Hs02_00355037 predicted 1325
4 SASI_Hs02_00355038 predicted 2125
5 SASI_Hs01_00024739 predicted 659
6 SASI_Hs02_00355039 predicted 1962
7 SASI_Hs01_00024740 predicted 855
8 SASI_Hs01_00024741 predicted 1228
9 SASI_Hs01_00024743 predicted 600
10 SASI_Hs01_00024745 predicted 956
11 SASI_Hs01_00024742 predicted 2150
12 SASI_Hs01_00024744 predicted 479
13 SASI_Hs01_00024746 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245910 predicted 1780
2 SASI_Hs01_00245911 predicted 1100
3 SASI_Hs02_00355040 predicted 1321
4 SASI_Hs02_00355041 predicted 2130
5 SASI_Hs01_00245912 predicted 664
6 SASI_Hs02_00355042 predicted 1962
7 SASI_Hs01_00245913 predicted 851
8 SASI_Hs01_00245914 predicted 1226
9 SASI_Hs01_00245916 predicted 606
10 SASI_Hs01_00245918 predicted 955
11 SASI_Hs01_00245915 predicted 2149
12 SASI_Hs01_00245917 predicted 476
13 SASI_Hs01_00245919 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095341 predicted 1026
2 SASI_Mm01_00095342 predicted 553
3 SASI_Mm01_00095343 predicted 997
4 SASI_Mm02_00286715 predicted 1451
5 SASI_Mm01_00095344 predicted 2194
6 SASI_Mm01_00095345 predicted 1999
7 SASI_Mm01_00095347 predicted 1821
8 SASI_Mm01_00095348 predicted 1251
9 SASI_Mm01_00095349 predicted 1147
10 SASI_Mm01_00095350 predicted 2087
11 SASI_Mm01_00095346 predicted 2156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132710 predicted 1029
2 SASI_Mm01_00132711 predicted 551
3 SASI_Mm01_00132712 predicted 996
4 SASI_Mm02_00286716 predicted 1455
5 SASI_Mm01_00132713 predicted 2192
6 SASI_Mm01_00132714 predicted 2001
7 SASI_Mm01_00132716 predicted 1823
8 SASI_Mm01_00132717 predicted 1253
9 SASI_Mm01_00132718 predicted 1146
10 SASI_Mm01_00132719 predicted 2087
11 SASI_Mm01_00132715 predicted 2154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301277 predicted 1030
2 SASI_Mm02_00301278 predicted 558
3 SASI_Mm02_00301279 predicted 998
4 SASI_Mm02_00301280 predicted 1455
5 SASI_Mm02_00301281 predicted 2188
6 SASI_Mm02_00301282 predicted 2003
7 SASI_Mm02_00301283 predicted 1819
8 SASI_Mm02_00301284 predicted 1252
9 SASI_Mm02_00301285 predicted 1143
10 SASI_Mm02_00301286 predicted 2094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007221
ADAM22 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 22
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000360686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007221.1-934s21c1
Sequence:CCGGCATGGCAGATGTGATCTATAACTCGAGTTATAGATCACATCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007221.1-1243s21c1
Sequence:CCGGAGCCCACAATGTCGGTATAATCTCGAGATTATACCGACATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007221
ADAM22 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 22
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000360686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007221.1-934s21c1
Sequence:CCGGCATGGCAGATGTGATCTATAACTCGAGTTATAGATCACATCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007221.1-1243s21c1
Sequence:CCGGAGCCCACAATGTCGGTATAATCTCGAGATTATACCGACATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007221
ADAM22 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 22
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000360686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007221.1-934s21c1
Sequence:CCGGCATGGCAGATGTGATCTATAACTCGAGTTATAGATCACATCTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007221.1-1243s21c1
Sequence:CCGGAGCCCACAATGTCGGTATAATCTCGAGATTATACCGACATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004194
ADAM22 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-758s21c1
Sequence:CCGGCTTCGTCGATATCCTCGTAATCTCGAGATTACGAGGATATCGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-1286s21c1
Sequence:CCGGATGGGAGACACTGGCTATTATCTCGAGATAATAGCCAGTGTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-2318s21c1
Sequence:CCGGTTAGTGCTGGCCCTCATATTACTCGAGTAATATGAGGGCCAGCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-1191s21c1
Sequence:CCGGCCCAGTCATTAGCCCATAATACTCGAGTATTATGGGCTAATGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-2121s21c1
Sequence:CCGGGCAGTAAAGAAGGCACTATTTCTCGAGAAATAGTGCCTTCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1190s1c1
Sequence:CCGGGCCCAGTCATTAGCCCATAATCTCGAGATTATGGGCTAATGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1103s1c1
Sequence:CCGGGCAGCTTATATTGGTGGGATTCTCGAGAATCCCACCAATATAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1725s1c1
Sequence:CCGGCCAGAGATAGACAATGCAAATCTCGAGATTTGCATTGTCTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-511s1c1
Sequence:CCGGCCCTGACTCATTTGTTGCATTCTCGAGAATGCAACAAATGAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-2121s1c1
Sequence:CCGGGCAGTAAAGAAGGCACTATTTCTCGAGAAATAGTGCCTTCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004194
ADAM22 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-758s21c1
Sequence:CCGGCTTCGTCGATATCCTCGTAATCTCGAGATTACGAGGATATCGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-1286s21c1
Sequence:CCGGATGGGAGACACTGGCTATTATCTCGAGATAATAGCCAGTGTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-2318s21c1
Sequence:CCGGTTAGTGCTGGCCCTCATATTACTCGAGTAATATGAGGGCCAGCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-1191s21c1
Sequence:CCGGCCCAGTCATTAGCCCATAATACTCGAGTATTATGGGCTAATGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-2121s21c1
Sequence:CCGGGCAGTAAAGAAGGCACTATTTCTCGAGAAATAGTGCCTTCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1190s1c1
Sequence:CCGGGCCCAGTCATTAGCCCATAATCTCGAGATTATGGGCTAATGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1103s1c1
Sequence:CCGGGCAGCTTATATTGGTGGGATTCTCGAGAATCCCACCAATATAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1725s1c1
Sequence:CCGGCCAGAGATAGACAATGCAAATCTCGAGATTTGCATTGTCTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-511s1c1
Sequence:CCGGCCCTGACTCATTTGTTGCATTCTCGAGAATGCAACAAATGAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-2121s1c1
Sequence:CCGGGCAGTAAAGAAGGCACTATTTCTCGAGAAATAGTGCCTTCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004194
ADAM22 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-758s21c1
Sequence:CCGGCTTCGTCGATATCCTCGTAATCTCGAGATTACGAGGATATCGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-1286s21c1
Sequence:CCGGATGGGAGACACTGGCTATTATCTCGAGATAATAGCCAGTGTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-2318s21c1
Sequence:CCGGTTAGTGCTGGCCCTCATATTACTCGAGTAATATGAGGGCCAGCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-1191s21c1
Sequence:CCGGCCCAGTCATTAGCCCATAATACTCGAGTATTATGGGCTAATGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004194.2-2121s21c1
Sequence:CCGGGCAGTAAAGAAGGCACTATTTCTCGAGAAATAGTGCCTTCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1190s1c1
Sequence:CCGGGCCCAGTCATTAGCCCATAATCTCGAGATTATGGGCTAATGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1103s1c1
Sequence:CCGGGCAGCTTATATTGGTGGGATTCTCGAGAATCCCACCAATATAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-1725s1c1
Sequence:CCGGCCAGAGATAGACAATGCAAATCTCGAGATTTGCATTGTCTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-511s1c1
Sequence:CCGGCCCTGACTCATTTGTTGCATTCTCGAGAATGCAACAAATGAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004194.2-2121s1c1
Sequence:CCGGGCAGTAAAGAAGGCACTATTTCTCGAGAAATAGTGCCTTCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131876
ADAM22 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-249s1c1
Sequence:CCGGCCATCTCCTGACAAACATAAACTCGAGTTTATGTTTGTCAGGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-909s1c1
Sequence:CCGGCCATGAGATCACCAGATTCAACTCGAGTTGAATCTGGTGATCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-1581s1c1
Sequence:CCGGGCCAAGACTAAAGAGGAGAAACTCGAGTTTCTCCTCTTTAGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-1532s1c1
Sequence:CCGGCGTCTGAATTTCAACGCGTAACTCGAGTTACGCGTTGAAATTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-315s1c1
Sequence:CCGGGCAATCCGAAATCGAAATCATCTCGAGATGATTTCGATTTCGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131876
ADAM22 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-249s1c1
Sequence:CCGGCCATCTCCTGACAAACATAAACTCGAGTTTATGTTTGTCAGGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-909s1c1
Sequence:CCGGCCATGAGATCACCAGATTCAACTCGAGTTGAATCTGGTGATCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-1581s1c1
Sequence:CCGGGCCAAGACTAAAGAGGAGAAACTCGAGTTTCTCCTCTTTAGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-1532s1c1
Sequence:CCGGCGTCTGAATTTCAACGCGTAACTCGAGTTACGCGTTGAAATTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-315s1c1
Sequence:CCGGGCAATCCGAAATCGAAATCATCTCGAGATGATTTCGATTTCGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131876
ADAM22 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-249s1c1
Sequence:CCGGCCATCTCCTGACAAACATAAACTCGAGTTTATGTTTGTCAGGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-909s1c1
Sequence:CCGGCCATGAGATCACCAGATTCAACTCGAGTTGAATCTGGTGATCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-1581s1c1
Sequence:CCGGGCCAAGACTAAAGAGGAGAAACTCGAGTTTCTCCTCTTTAGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-1532s1c1
Sequence:CCGGCGTCTGAATTTCAACGCGTAACTCGAGTTACGCGTTGAAATTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131876.3-315s1c1
Sequence:CCGGGCAATCCGAAATCGAAATCATCTCGAGATGATTTCGATTTCGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks