EMAIL THIS PAGE TO A FRIEND

ADAM23

ADAM metallopeptidase domain 23

55 Gene Product Result for
Synonyms: MDC-3 MDC3
UniProtKB ID: O75077, A2RU59
Gene ID:
Human(8745) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. It is reported that inactivation of this gene is associated with tumorigenesis in human cancers. [provided by RefSeq, May 2013]
Mouse(23792) a disintegrin and metallopeptidase domain 23
Rat(301460) ADAM metallopeptidase domain 23
naked mole-rat(101697492) ADAM metallopeptidase domain 23
domestic guinea pig(100717484) ADAM metallopeptidase domain 23
sheep(101105313) ADAM metallopeptidase domain 23
Domestic Rabbit(100354941) ADAM metallopeptidase domain 23
chicken(424099) ADAM metallopeptidase domain 23
dog(607871) ADAM metallopeptidase domain 23
Horse(100068579) ADAM metallopeptidase domain 23
cow(531241) ADAM metallopeptidase domain 23
domestic cat(101096503) ADAM metallopeptidase domain 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1250 Human ADAM23 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003812 Rosetta Predictions human pricing
NM_001029899 Rosetta Predictions rat pricing
NM_011780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106508 predicted 2010
2 SASI_Hs01_00106509 predicted 2213
3 SASI_Hs02_00336348 predicted 886
4 SASI_Hs01_00106512 predicted 1391
5 SASI_Hs01_00106513 predicted 1712
6 SASI_Hs01_00106514 predicted 1904
7 SASI_Hs01_00106515 predicted 2368
8 SASI_Hs02_00336349 predicted 1205
9 SASI_Hs01_00106516 predicted 1470
10 SASI_Hs02_00336350 predicted 1892
11 SASI_Hs01_00106510 predicted 1279
12 SASI_Hs01_00106511 predicted 2694
13 SASI_Hs01_00106517 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055239 predicted 1748
2 SASI_Rn01_00055240 predicted 2245
3 SASI_Rn01_00055241 predicted 1184
4 SASI_Rn01_00055242 predicted 1931
5 SASI_Rn02_00203462 predicted 2171
6 SASI_Rn01_00055243 predicted 2117
7 SASI_Rn01_00055244 predicted 2269
8 SASI_Rn01_00055245 predicted 568
9 SASI_Rn01_00055246 predicted 1859
10 SASI_Rn01_00055247 predicted 1560
11 SASI_Rn01_00055248 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175787 predicted 2157
2 SASI_Mm01_00175788 predicted 2471
3 SASI_Mm01_00175790 predicted 967
4 SASI_Mm01_00175791 predicted 2117
5 SASI_Mm02_00321425 predicted 1125
6 SASI_Mm01_00175792 predicted 2087
7 SASI_Mm02_00321426 predicted 1060
8 SASI_Mm01_00175793 predicted 1544
9 SASI_Mm01_00175794 predicted 1467
10 SASI_Mm02_00321427 predicted 2336
11 SASI_Mm01_00175786 predicted 805
12 SASI_Mm01_00175789 predicted 1073
13 SASI_Mm01_00175795 predicted 1420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003812
VALIDATED
ADAM23 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 23
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-2784s1c1
Sequence:CCGGGCAGTGTTACTGGAACTATTACTCGAGTAATAGTTCCAGTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003812.1-956s1c1
Sequence:CCGGCGACCACATATAATCCAGAAACTCGAGTTTCTGGATTATATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-2432s1c1
Sequence:CCGGCCACTCGATTCCAAGGGTAAACTCGAGTTTACCCTTGGAATCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-1392s1c1
Sequence:CCGGCGCGGGTGACATTTCACTATACTCGAGTATAGTGAAATGTCACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-1918s1c1
Sequence:CCGGCGAGTGTGATATTACTGAATACTCGAGTATTCAGTAATATCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003812.2-2200s21c1
Sequence:CCGGCTTACTCTGTACCAATCTTACCTCGAGGTAAGATTGGTACAGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003812.2-1086s21c1
Sequence:CCGGTGAATCCATCACGTGGTATATCTCGAGATATACCACGTGATGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003812
VALIDATED
ADAM23 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 23
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-2784s1c1
Sequence:CCGGGCAGTGTTACTGGAACTATTACTCGAGTAATAGTTCCAGTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003812.1-956s1c1
Sequence:CCGGCGACCACATATAATCCAGAAACTCGAGTTTCTGGATTATATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-2432s1c1
Sequence:CCGGCCACTCGATTCCAAGGGTAAACTCGAGTTTACCCTTGGAATCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-1392s1c1
Sequence:CCGGCGCGGGTGACATTTCACTATACTCGAGTATAGTGAAATGTCACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-1918s1c1
Sequence:CCGGCGAGTGTGATATTACTGAATACTCGAGTATTCAGTAATATCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003812.2-2200s21c1
Sequence:CCGGCTTACTCTGTACCAATCTTACCTCGAGGTAAGATTGGTACAGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003812.2-1086s21c1
Sequence:CCGGTGAATCCATCACGTGGTATATCTCGAGATATACCACGTGATGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003812
VALIDATED
ADAM23 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 23
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-2784s1c1
Sequence:CCGGGCAGTGTTACTGGAACTATTACTCGAGTAATAGTTCCAGTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003812.1-956s1c1
Sequence:CCGGCGACCACATATAATCCAGAAACTCGAGTTTCTGGATTATATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-2432s1c1
Sequence:CCGGCCACTCGATTCCAAGGGTAAACTCGAGTTTACCCTTGGAATCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-1392s1c1
Sequence:CCGGCGCGGGTGACATTTCACTATACTCGAGTATAGTGAAATGTCACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003812.1-1918s1c1
Sequence:CCGGCGAGTGTGATATTACTGAATACTCGAGTATTCAGTAATATCACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003812.2-2200s21c1
Sequence:CCGGCTTACTCTGTACCAATCTTACCTCGAGGTAAGATTGGTACAGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003812.2-1086s21c1
Sequence:CCGGTGAATCCATCACGTGGTATATCTCGAGATATACCACGTGATGGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011780
VALIDATED
ADAM23 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 23
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-803s1c1
Sequence:CCGGCGACCACACATAATCCAGAAACTCGAGTTTCTGGATTATGTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011780.1-2108s1c1
Sequence:CCGGCCGACTTCCTTCTATCATCAACTCGAGTTGATGATAGAAGGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-1575s1c1
Sequence:CCGGCCACGGAATGTGGAAATGGATCTCGAGATCCATTTCCACATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-453s1c1
Sequence:CCGGCCTATCATGTTCTTGACACAACTCGAGTTGTGTCAAGAACATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-2216s1c1
Sequence:CCGGCCCTCCATGATGTGCTTAGATCTCGAGATCTAAGCACATCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1565s21c1
Sequence:CCGGATGGCGGTGGCACAAGTATTACTCGAGTAATACTTGTGCCACCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1216s21c1
Sequence:CCGGTAATGATCACAAGACGTATAACTCGAGTTATACGTCTTGTGATCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011780.2-3017s21c1
Sequence:CCGGGGGTTAAAGACCATGTCATTACTCGAGTAATGACATGGTCTTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1513s21c1
Sequence:CCGGAGGCGTGTGTTCTCGAATAAGCTCGAGCTTATTCGAGAACACACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-2336s21c1
Sequence:CCGGCCGACTTCCTTCTATCATCAACTCGAGTTGATGATAGAAGGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011780
VALIDATED
ADAM23 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 23
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-803s1c1
Sequence:CCGGCGACCACACATAATCCAGAAACTCGAGTTTCTGGATTATGTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011780.1-2108s1c1
Sequence:CCGGCCGACTTCCTTCTATCATCAACTCGAGTTGATGATAGAAGGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-1575s1c1
Sequence:CCGGCCACGGAATGTGGAAATGGATCTCGAGATCCATTTCCACATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-453s1c1
Sequence:CCGGCCTATCATGTTCTTGACACAACTCGAGTTGTGTCAAGAACATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-2216s1c1
Sequence:CCGGCCCTCCATGATGTGCTTAGATCTCGAGATCTAAGCACATCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1565s21c1
Sequence:CCGGATGGCGGTGGCACAAGTATTACTCGAGTAATACTTGTGCCACCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1216s21c1
Sequence:CCGGTAATGATCACAAGACGTATAACTCGAGTTATACGTCTTGTGATCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011780.2-3017s21c1
Sequence:CCGGGGGTTAAAGACCATGTCATTACTCGAGTAATGACATGGTCTTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1513s21c1
Sequence:CCGGAGGCGTGTGTTCTCGAATAAGCTCGAGCTTATTCGAGAACACACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-2336s21c1
Sequence:CCGGCCGACTTCCTTCTATCATCAACTCGAGTTGATGATAGAAGGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011780
VALIDATED
ADAM23 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 23
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-803s1c1
Sequence:CCGGCGACCACACATAATCCAGAAACTCGAGTTTCTGGATTATGTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011780.1-2108s1c1
Sequence:CCGGCCGACTTCCTTCTATCATCAACTCGAGTTGATGATAGAAGGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-1575s1c1
Sequence:CCGGCCACGGAATGTGGAAATGGATCTCGAGATCCATTTCCACATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-453s1c1
Sequence:CCGGCCTATCATGTTCTTGACACAACTCGAGTTGTGTCAAGAACATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011780.1-2216s1c1
Sequence:CCGGCCCTCCATGATGTGCTTAGATCTCGAGATCTAAGCACATCATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1565s21c1
Sequence:CCGGATGGCGGTGGCACAAGTATTACTCGAGTAATACTTGTGCCACCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1216s21c1
Sequence:CCGGTAATGATCACAAGACGTATAACTCGAGTTATACGTCTTGTGATCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011780.2-3017s21c1
Sequence:CCGGGGGTTAAAGACCATGTCATTACTCGAGTAATGACATGGTCTTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-1513s21c1
Sequence:CCGGAGGCGTGTGTTCTCGAATAAGCTCGAGCTTATTCGAGAACACACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011780.2-2336s21c1
Sequence:CCGGCCGACTTCCTTCTATCATCAACTCGAGTTGATGATAGAAGGAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks