EMAIL THIS PAGE TO A FRIEND

ADAM28

ADAM metallopeptidase domain 28

154 Gene Product Result for
Synonyms: ADAM 28 ADAM23 MDC-L MDC-Lm MDC-Ls MDCL eMDC II eMDCII
UniProtKB ID: Q9UKQ2, B2RMV5, Q9Y339, Q9Y3S0
Gene ID:
Human(10863) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene is a lymphocyte-expressed ADAM protein. Alternative splicing results in two transcript variants. The shorter version encodes a secreted isoform, while the longer version encodes a transmembrane isoform. [provided by RefSeq, Jul 2008]
Mouse(13522) a disintegrin and metallopeptidase domain 28
Rat(290344) ADAM metallopeptidase domain 28
naked mole-rat(101702531) ADAM metallopeptidase domain 28
domestic guinea pig(100731350) ADAM metallopeptidase domain 28
sheep(101120058) ADAM metallopeptidase domain 28
Zebrafish(767749) a disintegrin and metallopeptidase domain 28
chicken(419529) ADAM metallopeptidase domain 28
dog(608753) ADAM metallopeptidase domain 28
domestic cat(101082815) ADAM metallopeptidase domain 28
Horse(100058721) ADAM metallopeptidase domain 28
cow(507019) ADAM metallopeptidase domain 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014265 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014265 Rosetta Predictions human pricing
NM_021777 Rosetta Predictions human pricing
NM_181693 Rosetta Predictions rat pricing
NM_001048175 Rosetta Predictions mouse pricing
NM_010082 Rosetta Predictions mouse pricing
NM_176991 Rosetta Predictions mouse pricing
NM_183366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125241 predicted 765
2 SASI_Hs01_00125243 predicted 716
3 SASI_Hs01_00125244 predicted 812
4 SASI_Hs01_00125245 predicted 1140
5 SASI_Hs01_00125246 predicted 686
6 SASI_Hs01_00125247 predicted 1317
7 SASI_Hs01_00125248 predicted 732
8 SASI_Hs01_00125249 predicted 545
9 SASI_Hs01_00125250 predicted 1336
10 SASI_Hs02_00345329 predicted 1111
11 SASI_Hs01_00125242 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081919 predicted 772
2 SASI_Hs01_00081921 predicted 709
3 SASI_Hs01_00081922 predicted 808
4 SASI_Hs01_00081923 predicted 1142
5 SASI_Hs01_00081924 predicted 683
6 SASI_Hs01_00081925 predicted 1319
7 SASI_Hs01_00081926 predicted 729
8 SASI_Hs01_00081927 predicted 550
9 SASI_Hs01_00081928 predicted 1338
10 SASI_Hs02_00355090 predicted 1110
11 SASI_Hs01_00081920 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109420 predicted 909
2 SASI_Rn01_00109421 predicted 314
3 SASI_Rn01_00109422 predicted 1110
4 SASI_Rn02_00269787 predicted 1841
5 SASI_Rn01_00109423 predicted 516
6 SASI_Rn01_00109424 predicted 2062
7 SASI_Rn01_00109425 predicted 1119
8 SASI_Rn01_00109426 predicted 727
9 SASI_Rn01_00109427 predicted 1447
10 SASI_Rn01_00109428 predicted 1166
11 SASI_Rn01_00109429 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292110 predicted 451
2 SASI_Mm02_00292111 predicted 1976
3 SASI_Mm02_00292112 predicted 221
4 SASI_Mm02_00292113 predicted 754
5 SASI_Mm02_00292114 predicted 310
6 SASI_Mm02_00292115 predicted 1849
7 SASI_Mm02_00292116 predicted 871
8 SASI_Mm02_00292117 predicted 1991
9 SASI_Mm02_00292118 predicted 857
10 SASI_Mm02_00292119 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043631 predicted 450
2 SASI_Mm01_00043632 predicted 1982
3 SASI_Mm02_00317773 predicted 217
4 SASI_Mm01_00043634 predicted 756
5 SASI_Mm01_00043635 predicted 315
6 SASI_Mm01_00043636 predicted 1851
7 SASI_Mm01_00043637 predicted 867
8 SASI_Mm01_00043638 predicted 1984
9 SASI_Mm01_00043639 predicted 855
10 SASI_Mm02_00317774 predicted 1176
11 SASI_Mm01_00043633 predicted 1163
12 SASI_Mm01_00043640 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179025 predicted 327
2 SASI_Mm01_00179026 predicted 426
3 SASI_Mm01_00179027 predicted 427
4 SASI_Mm01_00179028 predicted 458
5 SASI_Mm01_00179029 predicted 335
6 SASI_Mm01_00179030 predicted 381
7 SASI_Mm01_00179031 predicted 460
8 SASI_Mm01_00179032 predicted 399
9 SASI_Mm01_00179033 predicted 516
10 SASI_Mm01_00179034 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059796 predicted 450
2 SASI_Mm01_00059797 predicted 1982
3 SASI_Mm02_00350483 predicted 219
4 SASI_Mm01_00059799 predicted 753
5 SASI_Mm01_00059800 predicted 314
6 SASI_Mm01_00059801 predicted 1847
7 SASI_Mm01_00059802 predicted 868
8 SASI_Mm01_00059803 predicted 1993
9 SASI_Mm01_00059804 predicted 855
10 SASI_Mm02_00350484 predicted 1182
11 SASI_Mm01_00059798 predicted 1160
12 SASI_Mm01_00059805 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010082
ADAM28 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010082.1-2658s1c1
Sequence:CCGGCCCTGGAAAGTGGGTTACATTCTCGAGAATGTAACCCACTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-1516s1c1
Sequence:CCGGGCTGTGAGAAATGCCAACTTACTCGAGTAAGTTGGCATTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-232s1c1
Sequence:CCGGCCAAGAAATATGAAGTGGTTTCTCGAGAAACCACTTCATATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-1299s1c1
Sequence:CCGGCGTGTCAATTACAAACAGTTTCTCGAGAAACTGTTTGTAATTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-398s1c1
Sequence:CCGGGCCTGACTACTCGGAAACATACTCGAGTATGTTTCCGAGTAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010082
ADAM28 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010082.1-2658s1c1
Sequence:CCGGCCCTGGAAAGTGGGTTACATTCTCGAGAATGTAACCCACTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-1516s1c1
Sequence:CCGGGCTGTGAGAAATGCCAACTTACTCGAGTAAGTTGGCATTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-232s1c1
Sequence:CCGGCCAAGAAATATGAAGTGGTTTCTCGAGAAACCACTTCATATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-1299s1c1
Sequence:CCGGCGTGTCAATTACAAACAGTTTCTCGAGAAACTGTTTGTAATTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-398s1c1
Sequence:CCGGGCCTGACTACTCGGAAACATACTCGAGTATGTTTCCGAGTAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010082
ADAM28 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010082.1-2658s1c1
Sequence:CCGGCCCTGGAAAGTGGGTTACATTCTCGAGAATGTAACCCACTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-1516s1c1
Sequence:CCGGGCTGTGAGAAATGCCAACTTACTCGAGTAAGTTGGCATTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-232s1c1
Sequence:CCGGCCAAGAAATATGAAGTGGTTTCTCGAGAAACCACTTCATATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-1299s1c1
Sequence:CCGGCGTGTCAATTACAAACAGTTTCTCGAGAAACTGTTTGTAATTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010082.1-398s1c1
Sequence:CCGGGCCTGACTACTCGGAAACATACTCGAGTATGTTTCCGAGTAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014265
ADAM28 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 28
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-1185s1c1
Sequence:CCGGCGTCTCAGCTATGACAAGTTTCTCGAGAAACTTGTCATAGCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-1469s1c1
Sequence:CCGGGCCTGAAATGTGTAATGGTAACTCGAGTTACCATTACACATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014265.1-2388s1c1
Sequence:CCGGGCAAGAACTAATGGCTAAATTCTCGAGAATTTAGCCATTAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-680s1c1
Sequence:CCGGCCTGGATAATGGTGAGTTTAACTCGAGTTAAACTCACCATTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-774s21c1
Sequence:CCGGGTATTTGAGATGGCTAATTATCTCGAGATAATTAGCCATCTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-1781s21c1
Sequence:CCGGTCAAGGTGGGTCGGATAATTTCTCGAGAAATTATCCGACCCACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-2098s21c1
Sequence:CCGGTGTTCCCAATGGCGGTCATTTCTCGAGAAATGACCGCCATTGGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014265
ADAM28 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 28
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-1185s1c1
Sequence:CCGGCGTCTCAGCTATGACAAGTTTCTCGAGAAACTTGTCATAGCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-1469s1c1
Sequence:CCGGGCCTGAAATGTGTAATGGTAACTCGAGTTACCATTACACATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014265.1-2388s1c1
Sequence:CCGGGCAAGAACTAATGGCTAAATTCTCGAGAATTTAGCCATTAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-680s1c1
Sequence:CCGGCCTGGATAATGGTGAGTTTAACTCGAGTTAAACTCACCATTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-774s21c1
Sequence:CCGGGTATTTGAGATGGCTAATTATCTCGAGATAATTAGCCATCTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-1781s21c1
Sequence:CCGGTCAAGGTGGGTCGGATAATTTCTCGAGAAATTATCCGACCCACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-2098s21c1
Sequence:CCGGTGTTCCCAATGGCGGTCATTTCTCGAGAAATGACCGCCATTGGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014265
ADAM28 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 28
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-1185s1c1
Sequence:CCGGCGTCTCAGCTATGACAAGTTTCTCGAGAAACTTGTCATAGCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-1469s1c1
Sequence:CCGGGCCTGAAATGTGTAATGGTAACTCGAGTTACCATTACACATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014265.1-2388s1c1
Sequence:CCGGGCAAGAACTAATGGCTAAATTCTCGAGAATTTAGCCATTAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014265.1-680s1c1
Sequence:CCGGCCTGGATAATGGTGAGTTTAACTCGAGTTAAACTCACCATTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-774s21c1
Sequence:CCGGGTATTTGAGATGGCTAATTATCTCGAGATAATTAGCCATCTCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-1781s21c1
Sequence:CCGGTCAAGGTGGGTCGGATAATTTCTCGAGAAATTATCCGACCCACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014265.4-2098s21c1
Sequence:CCGGTGTTCCCAATGGCGGTCATTTCTCGAGAAATGACCGCCATTGGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks