EMAIL THIS PAGE TO A FRIEND

ADAM29

ADAM metallopeptidase domain 29

40 Gene Product Result for
Synonyms: CT73 svph1
UniProtKB ID: Q9UKF5, Q4W5F3, Q9UHP1, Q9UKF3, Q9UKF4
Gene ID:
Human(11086) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene is highly expressed in testis and may be involved in human spermatogenesis. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(244486) a disintegrin and metallopeptidase domain 29
dog(486075) ADAM metallopeptidase domain 29
domestic cat(101090099) ADAM metallopeptidase domain 29
Horse(100065626) ADAM metallopeptidase domain 29
cow(784116) ADAM metallopeptidase domain 29
sheep(101112201) ADAM metallopeptidase domain 29
domestic guinea pig(100722985) ADAM metallopeptidase domain 29
naked mole-rat(101708220) ADAM metallopeptidase domain 29
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014269 Rosetta Predictions human pricing
NM_175939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246348 predicted 2306
2 SASI_Hs01_00246349 predicted 1551
3 SASI_Hs01_00246350 predicted 1273
4 SASI_Hs01_00246351 predicted 1043
5 SASI_Hs02_00345334 predicted 2192
6 SASI_Hs01_00246352 predicted 2459
7 SASI_Hs01_00246354 predicted 2329
8 SASI_Hs02_00345335 predicted 1789
9 SASI_Hs02_00345336 predicted 1909
10 SASI_Hs02_00345337 predicted 2068
11 SASI_Hs01_00246353 predicted 2893
12 SASI_Hs01_00246355 predicted 1464
13 SASI_Hs01_00246356 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087324 predicted 1055
2 SASI_Mm01_00087325 predicted 1941
3 SASI_Mm01_00087326 predicted 729
4 SASI_Mm01_00087327 predicted 1736
5 SASI_Mm01_00087328 predicted 891
6 SASI_Mm01_00087330 predicted 689
7 SASI_Mm01_00087331 predicted 1009
8 SASI_Mm01_00087332 predicted 225
9 SASI_Mm02_00346699 predicted 1034
10 SASI_Mm02_00346700 predicted 1525
11 SASI_Mm01_00087323 predicted 1271
12 SASI_Mm01_00087329 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014269
ADAM29 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 29
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000432038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014269.4-2743s21c1
Sequence:CCGGATGTTGTCTTTATCGACTTTGCTCGAGCAAAGTCGATAAAGACAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014269.2-897s1c1
Sequence:CCGGCCGAATGGAATTTGAAGAAATCTCGAGATTTCTTCAAATTCCATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014269.2-664s1c1
Sequence:CCGGGTCCAGAATAACTGCTACTATCTCGAGATAGTAGCAGTTATTCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014269
ADAM29 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 29
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000432038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014269.4-2743s21c1
Sequence:CCGGATGTTGTCTTTATCGACTTTGCTCGAGCAAAGTCGATAAAGACAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014269.2-897s1c1
Sequence:CCGGCCGAATGGAATTTGAAGAAATCTCGAGATTTCTTCAAATTCCATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014269.2-664s1c1
Sequence:CCGGGTCCAGAATAACTGCTACTATCTCGAGATAGTAGCAGTTATTCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014269
ADAM29 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 29
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000432038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014269.4-2743s21c1
Sequence:CCGGATGTTGTCTTTATCGACTTTGCTCGAGCAAAGTCGATAAAGACAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014269.2-897s1c1
Sequence:CCGGCCGAATGGAATTTGAAGAAATCTCGAGATTTCTTCAAATTCCATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014269.2-664s1c1
Sequence:CCGGGTCCAGAATAACTGCTACTATCTCGAGATAGTAGCAGTTATTCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175939
ADAM29 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 29
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1926s1c1
Sequence:CCGGCCAATATGAAAGATCACAGTACTCGAGTACTGTGATCTTTCATATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1767s1c1
Sequence:CCGGGCCAGAATGCAAAGACTGCAACTCGAGTTGCAGTCTTTGCATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-427s1c1
Sequence:CCGGCCAGAGATACATCATCCACATCTCGAGATGTGGATGATGTATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1322s1c1
Sequence:CCGGCCGATACCCAAATTCAGCAATCTCGAGATTGCTGAATTTGGGTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-735s1c1
Sequence:CCGGGCCTTATGCAAGATAACATAACTCGAGTTATGTTATCTTGCATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175939
ADAM29 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 29
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1926s1c1
Sequence:CCGGCCAATATGAAAGATCACAGTACTCGAGTACTGTGATCTTTCATATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1767s1c1
Sequence:CCGGGCCAGAATGCAAAGACTGCAACTCGAGTTGCAGTCTTTGCATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-427s1c1
Sequence:CCGGCCAGAGATACATCATCCACATCTCGAGATGTGGATGATGTATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1322s1c1
Sequence:CCGGCCGATACCCAAATTCAGCAATCTCGAGATTGCTGAATTTGGGTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-735s1c1
Sequence:CCGGGCCTTATGCAAGATAACATAACTCGAGTTATGTTATCTTGCATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175939
ADAM29 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 29
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1926s1c1
Sequence:CCGGCCAATATGAAAGATCACAGTACTCGAGTACTGTGATCTTTCATATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1767s1c1
Sequence:CCGGGCCAGAATGCAAAGACTGCAACTCGAGTTGCAGTCTTTGCATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-427s1c1
Sequence:CCGGCCAGAGATACATCATCCACATCTCGAGATGTGGATGATGTATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-1322s1c1
Sequence:CCGGCCGATACCCAAATTCAGCAATCTCGAGATTGCTGAATTTGGGTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175939.2-735s1c1
Sequence:CCGGGCCTTATGCAAGATAACATAACTCGAGTTATGTTATCTTGCATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)