EMAIL THIS PAGE TO A FRIEND

ADAM2

ADAM metallopeptidase domain 2

61 Gene Product Result for
Synonyms: CRYN1 CRYN2 CT15 FTNB PH-30b PH30 PH30-beta
UniProtKB ID: Q99965, P78326, Q9UQQ8
Gene ID:
Human(2515) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded protein is a subunit of an integral sperm membrane glycoprotein called fertilin, which plays an important role in sperm-egg interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Mouse(11495) a disintegrin and metallopeptidase domain 2
Rat(56806) ADAM metallopeptidase domain 2
dog(475576) ADAM metallopeptidase domain 2
cow(281599) ADAM metallopeptidase domain 2
Horse(100057494) ADAM metallopeptidase domain 2
domestic cat(101097477) ADAM metallopeptidase domain 2
domestic guinea pig(100135471) a disintegrin and metallopeptidase domain 2
sheep(101120051) ADAM metallopeptidase domain 2
Domestic Rabbit(100009397) ADAM metallopeptidase domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001464 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001464 Rosetta Predictions human pricing
NM_020077 Rosetta Predictions rat pricing
NM_009618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172611 predicted 2229
2 SASI_Hs01_00172612 predicted 893
3 SASI_Hs01_00172614 predicted 1635
4 SASI_Hs02_00331904 predicted 217
5 SASI_Hs02_00331905 predicted 1519
6 SASI_Hs01_00172615 predicted 1134
7 SASI_Hs01_00172616 predicted 561
8 SASI_Hs01_00172617 predicted 1005
9 SASI_Hs01_00172618 predicted 1121
10 SASI_Hs01_00172619 predicted 2172
11 SASI_Hs01_00172613 predicted 2307
12 SASI_Hs01_00172620 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051852 predicted 463
2 SASI_Rn01_00051853 predicted 1654
3 SASI_Rn01_00051854 predicted 1457
4 SASI_Rn01_00051855 predicted 305
5 SASI_Rn01_00051856 predicted 1310
6 SASI_Rn01_00051857 predicted 461
7 SASI_Rn01_00051858 predicted 498
8 SASI_Rn01_00051859 predicted 1675
9 SASI_Rn01_00051860 predicted 1102
10 SASI_Rn02_00262480 predicted 417
11 SASI_Rn01_00051861 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107681 predicted 241
2 SASI_Mm01_00107682 predicted 1103
3 SASI_Mm01_00107683 predicted 297
4 SASI_Mm01_00107684 predicted 1934
5 SASI_Mm02_00316559 predicted 1608
6 SASI_Mm01_00107685 predicted 610
7 SASI_Mm02_00316560 predicted 1803
8 SASI_Mm01_00107686 predicted 1700
9 SASI_Mm02_00316561 predicted 310
10 SASI_Mm01_00107687 predicted 474
11 SASI_Mm01_00107688 predicted 287
12 SASI_Mm01_00107689 predicted 1798
13 SASI_Mm01_00107690 predicted 1513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009618
ADAM2 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-523s1c1
Sequence:CCGGGCAGTATAAGATACGAAGTATCTCGAGATACTTCGTATCTTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-1935s1c1
Sequence:CCGGCCACATACTTACCTCCAGATTCTCGAGAATCTGGAGGTAAGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-1847s1c1
Sequence:CCGGGCAGACACTTTCTTGGGCTATCTCGAGATAGCCCAAGAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-815s1c1
Sequence:CCGGCGACCACATGATATGGCGTTTCTCGAGAAACGCCATATCATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-232s1c1
Sequence:CCGGGCCTCCCAACTTTAGAGTATACTCGAGTATACTCTAAAGTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009618
ADAM2 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-523s1c1
Sequence:CCGGGCAGTATAAGATACGAAGTATCTCGAGATACTTCGTATCTTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-1935s1c1
Sequence:CCGGCCACATACTTACCTCCAGATTCTCGAGAATCTGGAGGTAAGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-1847s1c1
Sequence:CCGGGCAGACACTTTCTTGGGCTATCTCGAGATAGCCCAAGAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-815s1c1
Sequence:CCGGCGACCACATGATATGGCGTTTCTCGAGAAACGCCATATCATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-232s1c1
Sequence:CCGGGCCTCCCAACTTTAGAGTATACTCGAGTATACTCTAAAGTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009618
ADAM2 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-523s1c1
Sequence:CCGGGCAGTATAAGATACGAAGTATCTCGAGATACTTCGTATCTTATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-1935s1c1
Sequence:CCGGCCACATACTTACCTCCAGATTCTCGAGAATCTGGAGGTAAGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-1847s1c1
Sequence:CCGGGCAGACACTTTCTTGGGCTATCTCGAGATAGCCCAAGAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-815s1c1
Sequence:CCGGCGACCACATGATATGGCGTTTCTCGAGAAACGCCATATCATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009618.1-232s1c1
Sequence:CCGGGCCTCCCAACTTTAGAGTATACTCGAGTATACTCTAAAGTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001464
ADAM2 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001464.2-2379s1c1
Sequence:CCGGCCTGGGATTCAAACCTGCATACTCGAGTATGCAGGTTTGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-1977s1c1
Sequence:CCGGGCTTCATATTTACCTCCAGATCTCGAGATCTGGAGGTAAATATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-1075s1c1
Sequence:CCGGGCATTATGAATCCAGAAGCAACTCGAGTTGCTTCTGGATTCATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-2087s1c1
Sequence:CCGGGCGCTACATTGAGAACATTTACTCGAGTAAATGTTCTCAATGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-964s1c1
Sequence:CCGGCCAGAACCATAAGTCTGGAATCTCGAGATTCCAGACTTATGGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-114s21c1
Sequence:CCGGGCTGCGGATGGACAGTAATTTCTCGAGAAATTACTGTCCATCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-1109s21c1
Sequence:CCGGTCAGTGGTGTGAAGATCTTTACTCGAGTAAAGATCTTCACACCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-1744s21c1
Sequence:CCGGATTCCAAGAGCCACTATTATTCTCGAGAATAATAGTGGCTCTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-349s21c1
Sequence:CCGGTGCCACTACCAAGGGTATATTCTCGAGAATATACCCTTGGTAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001464
ADAM2 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001464.2-2379s1c1
Sequence:CCGGCCTGGGATTCAAACCTGCATACTCGAGTATGCAGGTTTGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-1977s1c1
Sequence:CCGGGCTTCATATTTACCTCCAGATCTCGAGATCTGGAGGTAAATATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-1075s1c1
Sequence:CCGGGCATTATGAATCCAGAAGCAACTCGAGTTGCTTCTGGATTCATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-2087s1c1
Sequence:CCGGGCGCTACATTGAGAACATTTACTCGAGTAAATGTTCTCAATGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-964s1c1
Sequence:CCGGCCAGAACCATAAGTCTGGAATCTCGAGATTCCAGACTTATGGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-114s21c1
Sequence:CCGGGCTGCGGATGGACAGTAATTTCTCGAGAAATTACTGTCCATCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-1109s21c1
Sequence:CCGGTCAGTGGTGTGAAGATCTTTACTCGAGTAAAGATCTTCACACCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-1744s21c1
Sequence:CCGGATTCCAAGAGCCACTATTATTCTCGAGAATAATAGTGGCTCTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-349s21c1
Sequence:CCGGTGCCACTACCAAGGGTATATTCTCGAGAATATACCCTTGGTAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001464
ADAM2 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001464.2-2379s1c1
Sequence:CCGGCCTGGGATTCAAACCTGCATACTCGAGTATGCAGGTTTGAATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-1977s1c1
Sequence:CCGGGCTTCATATTTACCTCCAGATCTCGAGATCTGGAGGTAAATATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-1075s1c1
Sequence:CCGGGCATTATGAATCCAGAAGCAACTCGAGTTGCTTCTGGATTCATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-2087s1c1
Sequence:CCGGGCGCTACATTGAGAACATTTACTCGAGTAAATGTTCTCAATGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001464.2-964s1c1
Sequence:CCGGCCAGAACCATAAGTCTGGAATCTCGAGATTCCAGACTTATGGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-114s21c1
Sequence:CCGGGCTGCGGATGGACAGTAATTTCTCGAGAAATTACTGTCCATCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-1109s21c1
Sequence:CCGGTCAGTGGTGTGAAGATCTTTACTCGAGTAAAGATCTTCACACCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-1744s21c1
Sequence:CCGGATTCCAAGAGCCACTATTATTCTCGAGAATAATAGTGGCTCTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001464.3-349s21c1
Sequence:CCGGTGCCACTACCAAGGGTATATTCTCGAGAATATACCCTTGGTAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks