EMAIL THIS PAGE TO A FRIEND

ADAM30

ADAM metallopeptidase domain 30

58 Gene Product Result for
Synonyms: svph4
UniProtKB ID: Q9UKF2, A8K8W8, Q5T3X6, Q9UKF1
Gene ID:
Human(11085) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]
Mouse(71078) a disintegrin and metallopeptidase domain 30
Rat(690547) ADAM metallopeptidase domain 30
Domestic Rabbit(100344330) ADAM metallopeptidase domain 30
Horse(100067035) ADAM metallopeptidase domain 30
cow(789334) ADAM metallopeptidase domain 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021794 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021794 Rosetta Predictions human pricing
NM_001109600 Rosetta Predictions rat pricing
NM_027665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145853 predicted 945
2 SASI_Hs01_00145854 predicted 1730
3 SASI_Hs01_00145856 predicted 521
4 SASI_Hs01_00145857 predicted 1485
5 SASI_Hs02_00355095 predicted 1582
6 SASI_Hs01_00145858 predicted 478
7 SASI_Hs01_00145859 predicted 1092
8 SASI_Hs01_00145860 predicted 204
9 SASI_Hs01_00145861 predicted 1485
10 SASI_Hs01_00145862 predicted 1545
11 SASI_Hs01_00145855 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249967 predicted 679
2 SASI_Rn02_00249968 predicted 624
3 SASI_Rn02_00249969 predicted 630
4 SASI_Rn02_00249970 predicted 400
5 SASI_Rn02_00249971 predicted 697
6 SASI_Rn02_00249972 predicted 1661
7 SASI_Rn02_00249973 predicted 662
8 SASI_Rn02_00249974 predicted 1665
9 SASI_Rn02_00249975 predicted 1084
10 SASI_Rn02_00249976 predicted 1731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189364 predicted 1684
2 SASI_Mm02_00332553 predicted 679
3 SASI_Mm01_00189365 predicted 1737
4 SASI_Mm01_00189366 predicted 496
5 SASI_Mm01_00189367 predicted 1877
6 SASI_Mm01_00189368 predicted 339
7 SASI_Mm01_00189369 predicted 878
8 SASI_Mm01_00189370 predicted 1559
9 SASI_Mm01_00189371 predicted 2071
10 SASI_Mm01_00189373 predicted 623
11 SASI_Mm01_00189372 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027665
ADAM30 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 30
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-825s1c1
Sequence:CCGGCGTCTTTATTATCCCAGTTTACTCGAGTAAACTGGGATAATAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-403s1c1
Sequence:CCGGCCGAATCTACTCTGAGTACATCTCGAGATGTACTCAGAGTAGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-1957s1c1
Sequence:CCGGGCCGAGGTGTTTGCAACAATACTCGAGTATTGTTGCAAACACCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-269s1c1
Sequence:CCGGGCGACCCAAGAAGTTACTGTTCTCGAGAACAGTAACTTCTTGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-499s21c1
Sequence:CCGGGTTTCGAACACGTGGTGTATCCTCGAGGATACACCACGTGTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-742s21c1
Sequence:CCGGCAATTGCAGACACCTACTTTCCTCGAGGAAAGTAGGTGTCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-113s21c1
Sequence:CCGGAGGCGAAGAAGACCTACTATTCTCGAGAATAGTAGGTCTTCTTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-335s21c1
Sequence:CCGGGATAGAGGATTATCCGCATATCTCGAGATATGCGGATAATCCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027665
ADAM30 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 30
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-825s1c1
Sequence:CCGGCGTCTTTATTATCCCAGTTTACTCGAGTAAACTGGGATAATAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-403s1c1
Sequence:CCGGCCGAATCTACTCTGAGTACATCTCGAGATGTACTCAGAGTAGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-1957s1c1
Sequence:CCGGGCCGAGGTGTTTGCAACAATACTCGAGTATTGTTGCAAACACCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-269s1c1
Sequence:CCGGGCGACCCAAGAAGTTACTGTTCTCGAGAACAGTAACTTCTTGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-499s21c1
Sequence:CCGGGTTTCGAACACGTGGTGTATCCTCGAGGATACACCACGTGTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-742s21c1
Sequence:CCGGCAATTGCAGACACCTACTTTCCTCGAGGAAAGTAGGTGTCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-113s21c1
Sequence:CCGGAGGCGAAGAAGACCTACTATTCTCGAGAATAGTAGGTCTTCTTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-335s21c1
Sequence:CCGGGATAGAGGATTATCCGCATATCTCGAGATATGCGGATAATCCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027665
ADAM30 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 30
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-825s1c1
Sequence:CCGGCGTCTTTATTATCCCAGTTTACTCGAGTAAACTGGGATAATAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-403s1c1
Sequence:CCGGCCGAATCTACTCTGAGTACATCTCGAGATGTACTCAGAGTAGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-1957s1c1
Sequence:CCGGGCCGAGGTGTTTGCAACAATACTCGAGTATTGTTGCAAACACCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027665.1-269s1c1
Sequence:CCGGGCGACCCAAGAAGTTACTGTTCTCGAGAACAGTAACTTCTTGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-499s21c1
Sequence:CCGGGTTTCGAACACGTGGTGTATCCTCGAGGATACACCACGTGTTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-742s21c1
Sequence:CCGGCAATTGCAGACACCTACTTTCCTCGAGGAAAGTAGGTGTCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-113s21c1
Sequence:CCGGAGGCGAAGAAGACCTACTATTCTCGAGAATAGTAGGTCTTCTTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027665.1-335s21c1
Sequence:CCGGGATAGAGGATTATCCGCATATCTCGAGATATGCGGATAATCCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021794
ADAM30 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 30
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-1581s1c1
Sequence:CCGGCCTGCCCAAATGACGTTTATACTCGAGTATAAACGTCATTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-2223s1c1
Sequence:CCGGCCATCATAATGTTTCGCCTTACTCGAGTAAGGCGAAACATTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-269s1c1
Sequence:CCGGGACTCGTATGAAGTCACCATTCTCGAGAATGGTGACTTCATACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-870s1c1
Sequence:CCGGCCTACTTTCAAGATGTTCGTACTCGAGTACGAACATCTTGAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-1858s1c1
Sequence:CCGGGCCAGAGCATACGACTATAATCTCGAGATTATAGTCGTATGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-513s21c1
Sequence:CCGGTGGACTCTAAAGCTACTATAACTCGAGTTATAGTAGCTTTAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-1019s21c1
Sequence:CCGGTCATCAGATTGGGCACATTTACTCGAGTAAATGTGCCCAATCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-734s21c1
Sequence:CCGGGACTTTCCTGGATCCTATAAACTCGAGTTTATAGGATCCAGGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-1106s21c1
Sequence:CCGGGCTGGATCAGTGAGTACTTTACTCGAGTAAAGTACTCACTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021794
ADAM30 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 30
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-1581s1c1
Sequence:CCGGCCTGCCCAAATGACGTTTATACTCGAGTATAAACGTCATTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-2223s1c1
Sequence:CCGGCCATCATAATGTTTCGCCTTACTCGAGTAAGGCGAAACATTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-269s1c1
Sequence:CCGGGACTCGTATGAAGTCACCATTCTCGAGAATGGTGACTTCATACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-870s1c1
Sequence:CCGGCCTACTTTCAAGATGTTCGTACTCGAGTACGAACATCTTGAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-1858s1c1
Sequence:CCGGGCCAGAGCATACGACTATAATCTCGAGATTATAGTCGTATGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-513s21c1
Sequence:CCGGTGGACTCTAAAGCTACTATAACTCGAGTTATAGTAGCTTTAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-1019s21c1
Sequence:CCGGTCATCAGATTGGGCACATTTACTCGAGTAAATGTGCCCAATCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-734s21c1
Sequence:CCGGGACTTTCCTGGATCCTATAAACTCGAGTTTATAGGATCCAGGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-1106s21c1
Sequence:CCGGGCTGGATCAGTGAGTACTTTACTCGAGTAAAGTACTCACTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021794
ADAM30 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 30
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-1581s1c1
Sequence:CCGGCCTGCCCAAATGACGTTTATACTCGAGTATAAACGTCATTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-2223s1c1
Sequence:CCGGCCATCATAATGTTTCGCCTTACTCGAGTAAGGCGAAACATTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-269s1c1
Sequence:CCGGGACTCGTATGAAGTCACCATTCTCGAGAATGGTGACTTCATACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-870s1c1
Sequence:CCGGCCTACTTTCAAGATGTTCGTACTCGAGTACGAACATCTTGAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021794.2-1858s1c1
Sequence:CCGGGCCAGAGCATACGACTATAATCTCGAGATTATAGTCGTATGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-513s21c1
Sequence:CCGGTGGACTCTAAAGCTACTATAACTCGAGTTATAGTAGCTTTAGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-1019s21c1
Sequence:CCGGTCATCAGATTGGGCACATTTACTCGAGTAAATGTGCCCAATCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-734s21c1
Sequence:CCGGGACTTTCCTGGATCCTATAAACTCGAGTTTATAGGATCCAGGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021794.2-1106s21c1
Sequence:CCGGGCTGGATCAGTGAGTACTTTACTCGAGTAAAGTACTCACTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks