EMAIL THIS PAGE TO A FRIEND

ADAM33

ADAM metallopeptidase domain 33

60 Gene Product Result for
Synonyms: C20orf153 DJ964F7.1
UniProtKB ID: Q9BZ11, A0A1K6, Q5JT75, Q5JT76, Q8N0W6
Gene ID:
Human(80332) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This protein is a type I transmembrane protein implicated in asthma and bronchial hyperresponsiveness. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(110751) a disintegrin and metallopeptidase domain 33
Rat(311425) ADAM metallopeptidase domain 33
naked mole-rat(101698171) ADAM metallopeptidase domain 33
domestic guinea pig(100714049) ADAM metallopeptidase domain 33
sheep(101111218) ADAM metallopeptidase domain 33
chicken(422948) ADAM metallopeptidase domain 33
cow(523627) ADAM metallopeptidase domain 33
Horse(100066376) ADAM metallopeptidase domain 33
domestic cat(101093514) ADAM metallopeptidase domain 33
dog(485795) ADAM metallopeptidase domain 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025220 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053451 MISSION® esiRNA esiRNA targeting mouse Adam33 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025220 Rosetta Predictions human pricing
NM_153202 Rosetta Predictions human pricing
NM_001107776 Rosetta Predictions rat pricing
NM_033615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066878 predicted 598
2 SASI_Hs01_00066880 predicted 808
3 SASI_Hs01_00066881 predicted 2738
4 SASI_Hs01_00066883 predicted 2850
5 SASI_Hs01_00066884 predicted 708
6 SASI_Hs01_00066885 predicted 2911
7 SASI_Hs01_00066886 predicted 732
8 SASI_Hs02_00358012 predicted 2816
9 SASI_Hs01_00066887 predicted 1221
10 SASI_Hs02_00358013 predicted 1578
11 SASI_Hs01_00066879 predicted 2867
12 SASI_Hs01_00066882 predicted 2821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238625 predicted 597
2 SASI_Hs01_00238627 predicted 801
3 SASI_Hs01_00238628 predicted 2665
4 SASI_Hs01_00238630 predicted 2771
5 SASI_Hs01_00238631 predicted 715
6 SASI_Hs01_00238632 predicted 2829
7 SASI_Hs01_00238633 predicted 736
8 SASI_Hs02_00367045 predicted 2737
9 SASI_Hs01_00238634 predicted 1216
10 SASI_Hs02_00367046 predicted 1579
11 SASI_Hs01_00238626 predicted 2792
12 SASI_Hs01_00238629 predicted 2748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232155 predicted 932
2 SASI_Rn02_00232156 predicted 1040
3 SASI_Rn02_00232157 predicted 2130
4 SASI_Rn02_00232158 predicted 2016
5 SASI_Rn02_00232159 predicted 1537
6 SASI_Rn02_00232160 predicted 916
7 SASI_Rn02_00232161 predicted 1994
8 SASI_Rn02_00232162 predicted 1201
9 SASI_Rn02_00232163 predicted 2033
10 SASI_Rn02_00232164 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190514 predicted 2483
2 SASI_Mm01_00190515 predicted 2281
3 SASI_Mm01_00190516 predicted 2064
4 SASI_Mm01_00190517 predicted 1917
5 SASI_Mm01_00190518 predicted 1792
6 SASI_Mm01_00190519 predicted 2067
7 SASI_Mm01_00190520 predicted 1696
8 SASI_Mm01_00190521 predicted 2571
9 SASI_Mm01_00190522 predicted 1245
10 SASI_Mm01_00190523 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025220
VALIDATED
ADAM33 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 33
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-769s1c1
Sequence:CCGGCGAAACTTGAACCACACCAAACTCGAGTTTGGTGTGGTTCAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-428s1c1
Sequence:CCGGGCCACTACCAAGGGCGAGTAACTCGAGTTACTCGCCCTTGGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-513s1c1
Sequence:CCGGCAGCAGGAATGCCAGCTATTACTCGAGTAATAGCTGGCATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025220.2-808s1c1
Sequence:CCGGGCCAACTACGTGGACCAGCTTCTCGAGAAGCTGGTCCACGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-1867s1c1
Sequence:CCGGGACTCTACCGTTCACCTAGATCTCGAGATCTAGGTGAACGGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-742s21c1
Sequence:CCGGGACCACACCCTGTTCTTGACTCTCGAGAGTCAAGAACAGGGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-2499s21c1
Sequence:CCGGAGTCCAGATGCCAAGATCCTGCTCGAGCAGGATCTTGGCATCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-1413s21c1
Sequence:CCGGCTGCTGCTTTGCTCACAACTGCTCGAGCAGTTGTGAGCAAAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-569s21c1
Sequence:CCGGTCTCAACCCACGAGATCTTTCCTCGAGGAAAGATCTCGTGGGTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-357s21c1
Sequence:CCGGAGGATACATAGAAACCCACTACTCGAGTAGTGGGTTTCTATGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-2524s21c1
Sequence:CCGGTGGTGAGAGGTAGCTCCTAAACTCGAGTTTAGGAGCTACCTCTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-716s21c1
Sequence:CCGGAGTACCTGGAACTGTACATTGCTCGAGCAATGTACAGTTCCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025220.2-2990s21c1
Sequence:CCGGCCTCTGCAAACAAACATAATTCTCGAGAATTATGTTTGTTTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025220.2-2868s21c1
Sequence:CCGGGTGTCTCCTACATGCAATTTCCTCGAGGAAATTGCATGTAGGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025220
VALIDATED
ADAM33 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 33
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-769s1c1
Sequence:CCGGCGAAACTTGAACCACACCAAACTCGAGTTTGGTGTGGTTCAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-428s1c1
Sequence:CCGGGCCACTACCAAGGGCGAGTAACTCGAGTTACTCGCCCTTGGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-513s1c1
Sequence:CCGGCAGCAGGAATGCCAGCTATTACTCGAGTAATAGCTGGCATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025220.2-808s1c1
Sequence:CCGGGCCAACTACGTGGACCAGCTTCTCGAGAAGCTGGTCCACGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-1867s1c1
Sequence:CCGGGACTCTACCGTTCACCTAGATCTCGAGATCTAGGTGAACGGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-742s21c1
Sequence:CCGGGACCACACCCTGTTCTTGACTCTCGAGAGTCAAGAACAGGGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-2499s21c1
Sequence:CCGGAGTCCAGATGCCAAGATCCTGCTCGAGCAGGATCTTGGCATCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-1413s21c1
Sequence:CCGGCTGCTGCTTTGCTCACAACTGCTCGAGCAGTTGTGAGCAAAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-569s21c1
Sequence:CCGGTCTCAACCCACGAGATCTTTCCTCGAGGAAAGATCTCGTGGGTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-357s21c1
Sequence:CCGGAGGATACATAGAAACCCACTACTCGAGTAGTGGGTTTCTATGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-2524s21c1
Sequence:CCGGTGGTGAGAGGTAGCTCCTAAACTCGAGTTTAGGAGCTACCTCTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-716s21c1
Sequence:CCGGAGTACCTGGAACTGTACATTGCTCGAGCAATGTACAGTTCCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025220.2-2990s21c1
Sequence:CCGGCCTCTGCAAACAAACATAATTCTCGAGAATTATGTTTGTTTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025220.2-2868s21c1
Sequence:CCGGGTGTCTCCTACATGCAATTTCCTCGAGGAAATTGCATGTAGGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025220
VALIDATED
ADAM33 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 33
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-769s1c1
Sequence:CCGGCGAAACTTGAACCACACCAAACTCGAGTTTGGTGTGGTTCAAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-428s1c1
Sequence:CCGGGCCACTACCAAGGGCGAGTAACTCGAGTTACTCGCCCTTGGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-513s1c1
Sequence:CCGGCAGCAGGAATGCCAGCTATTACTCGAGTAATAGCTGGCATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025220.2-808s1c1
Sequence:CCGGGCCAACTACGTGGACCAGCTTCTCGAGAAGCTGGTCCACGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025220.2-1867s1c1
Sequence:CCGGGACTCTACCGTTCACCTAGATCTCGAGATCTAGGTGAACGGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-742s21c1
Sequence:CCGGGACCACACCCTGTTCTTGACTCTCGAGAGTCAAGAACAGGGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-2499s21c1
Sequence:CCGGAGTCCAGATGCCAAGATCCTGCTCGAGCAGGATCTTGGCATCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-1413s21c1
Sequence:CCGGCTGCTGCTTTGCTCACAACTGCTCGAGCAGTTGTGAGCAAAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-569s21c1
Sequence:CCGGTCTCAACCCACGAGATCTTTCCTCGAGGAAAGATCTCGTGGGTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-357s21c1
Sequence:CCGGAGGATACATAGAAACCCACTACTCGAGTAGTGGGTTTCTATGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-2524s21c1
Sequence:CCGGTGGTGAGAGGTAGCTCCTAAACTCGAGTTTAGGAGCTACCTCTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025220.2-716s21c1
Sequence:CCGGAGTACCTGGAACTGTACATTGCTCGAGCAATGTACAGTTCCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025220.2-2990s21c1
Sequence:CCGGCCTCTGCAAACAAACATAATTCTCGAGAATTATGTTTGTTTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025220.2-2868s21c1
Sequence:CCGGGTGTCTCCTACATGCAATTTCCTCGAGGAAATTGCATGTAGGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033615
ADAM33 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-385s1c1
Sequence:CCGGGCTCGGATGTTTCCAGGAAATCTCGAGATTTCCTGGAAACATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-631s1c1
Sequence:CCGGCACACGGATCATTGCCAATATCTCGAGATATTGGCAATGATCCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-2074s1c1
Sequence:CCGGGTGACTATGGACTCCACAATTCTCGAGAATTGTGGAGTCCATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-1920s1c1
Sequence:CCGGGCCATGTTTCCAGCAGATGAACTCGAGTTCATCTGCTGGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-852s1c1
Sequence:CCGGCTCCCAATACAAAGCAGGAATCTCGAGATTCCTGCTTTGTATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033615
ADAM33 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-385s1c1
Sequence:CCGGGCTCGGATGTTTCCAGGAAATCTCGAGATTTCCTGGAAACATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-631s1c1
Sequence:CCGGCACACGGATCATTGCCAATATCTCGAGATATTGGCAATGATCCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-2074s1c1
Sequence:CCGGGTGACTATGGACTCCACAATTCTCGAGAATTGTGGAGTCCATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-1920s1c1
Sequence:CCGGGCCATGTTTCCAGCAGATGAACTCGAGTTCATCTGCTGGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-852s1c1
Sequence:CCGGCTCCCAATACAAAGCAGGAATCTCGAGATTCCTGCTTTGTATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033615
ADAM33 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-385s1c1
Sequence:CCGGGCTCGGATGTTTCCAGGAAATCTCGAGATTTCCTGGAAACATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-631s1c1
Sequence:CCGGCACACGGATCATTGCCAATATCTCGAGATATTGGCAATGATCCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-2074s1c1
Sequence:CCGGGTGACTATGGACTCCACAATTCTCGAGAATTGTGGAGTCCATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-1920s1c1
Sequence:CCGGGCCATGTTTCCAGCAGATGAACTCGAGTTCATCTGCTGGAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033615.1-852s1c1
Sequence:CCGGCTCCCAATACAAAGCAGGAATCTCGAGATTCCTGCTTTGTATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks