EMAIL THIS PAGE TO A FRIEND

ADAM5

ADAM metallopeptidase domain 5, pseudogene

172 Gene Product Result for
Synonyms: ADAM5P TMDCII
UniProtKB ID: Q6NVV9, A8MW71, Q4G196
Gene ID:
Mouse(11499) a disintegrin and metallopeptidase domain 5
Rat(498654) a disintegrin and metallopeptidase domain 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087451 MISSION® esiRNA esiRNA targeting mouse Adam5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_001448 Rosetta Predictions human pricing
NM_020303 Rosetta Predictions rat pricing
XM_573936 Rosetta Predictions rat pricing
NM_007401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_001448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374796 predicted 541
2 SASI_Hs02_00374797 predicted 1187
3 SASI_Hs02_00374798 predicted 1416
4 SASI_Hs02_00374799 predicted 1099
5 SASI_Hs02_00374800 predicted 704
6 SASI_Hs02_00374801 predicted 1203
7 SASI_Hs02_00374802 predicted 1443
8 SASI_Hs02_00374803 predicted 769
9 SASI_Hs02_00374804 predicted 737
10 SASI_Hs02_00374805 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035132 predicted 1762
2 SASI_Rn01_00035133 predicted 617
3 SASI_Rn01_00035134 predicted 1765
4 SASI_Rn01_00035135 predicted 1745
5 SASI_Rn02_00262545 predicted 981
6 SASI_Rn01_00035137 predicted 741
7 SASI_Rn01_00035138 predicted 673
8 SASI_Rn01_00035140 predicted 2044
9 SASI_Rn02_00262546 predicted 710
10 SASI_Rn02_00262547 predicted 1820
11 SASI_Rn01_00035131 predicted 2032
12 SASI_Rn01_00035136 predicted 643
13 SASI_Rn01_00035139 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166517 predicted 1547
2 SASI_Rn01_00166518 predicted 1288
3 SASI_Rn01_00166519 predicted 1299
4 SASI_Rn01_00166520 predicted 1282
5 SASI_Rn01_00166521 predicted 521
6 SASI_Rn01_00166522 predicted 344
7 SASI_Rn01_00166523 predicted 621
8 SASI_Rn01_00166524 predicted 1417
9 SASI_Rn01_00166525 predicted 1551
10 SASI_Rn01_00166526 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050445 predicted 903
2 SASI_Mm01_00050446 predicted 776
3 SASI_Mm01_00050447 predicted 1766
4 SASI_Mm01_00050448 predicted 1679
5 SASI_Mm01_00050450 predicted 1618
6 SASI_Mm02_00311516 predicted 1117
7 SASI_Mm01_00050452 predicted 910
8 SASI_Mm01_00050453 predicted 655
9 SASI_Mm02_00311517 predicted 954
10 SASI_Mm02_00311518 predicted 844
11 SASI_Mm01_00050449 predicted 1182
12 SASI_Mm01_00050451 predicted 1570
13 SASI_Mm01_00050454 predicted 1546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007401
ADAM5 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 5, pseudogene
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007401.1-2274s1c1
Sequence:CCGGCAAGTATTGCTACCCCAAAAGCTCGAGCTTTTGGGGTAGCAATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-1553s1c1
Sequence:CCGGGCGTGCTATGAAGAGTTCAATCTCGAGATTGAACTCTTCATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-761s1c1
Sequence:CCGGGCAGTTGATGACTTATTGGTTCTCGAGAACCAATAAGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-1011s1c1
Sequence:CCGGGCCACTGTACAGGAGAAGTTTCTCGAGAAACTTCTCCTGTACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-2010s1c1
Sequence:CCGGGCGTTGATGATGGACATAAATCTCGAGATTTATGTCCATCATCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007401.2-1680s21c1
Sequence:CCGGTAGTCAAGATTGCACGGTAAACTCGAGTTTACCGTGCAATCTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007401.2-917s21c1
Sequence:CCGGTGTTACGCCAACGATTCATTACTCGAGTAATGAATCGTTGGCGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007401
ADAM5 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 5, pseudogene
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007401.1-2274s1c1
Sequence:CCGGCAAGTATTGCTACCCCAAAAGCTCGAGCTTTTGGGGTAGCAATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-1553s1c1
Sequence:CCGGGCGTGCTATGAAGAGTTCAATCTCGAGATTGAACTCTTCATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-761s1c1
Sequence:CCGGGCAGTTGATGACTTATTGGTTCTCGAGAACCAATAAGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-1011s1c1
Sequence:CCGGGCCACTGTACAGGAGAAGTTTCTCGAGAAACTTCTCCTGTACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-2010s1c1
Sequence:CCGGGCGTTGATGATGGACATAAATCTCGAGATTTATGTCCATCATCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007401.2-1680s21c1
Sequence:CCGGTAGTCAAGATTGCACGGTAAACTCGAGTTTACCGTGCAATCTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007401.2-917s21c1
Sequence:CCGGTGTTACGCCAACGATTCATTACTCGAGTAATGAATCGTTGGCGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007401
ADAM5 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 5, pseudogene
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007401.1-2274s1c1
Sequence:CCGGCAAGTATTGCTACCCCAAAAGCTCGAGCTTTTGGGGTAGCAATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-1553s1c1
Sequence:CCGGGCGTGCTATGAAGAGTTCAATCTCGAGATTGAACTCTTCATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-761s1c1
Sequence:CCGGGCAGTTGATGACTTATTGGTTCTCGAGAACCAATAAGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-1011s1c1
Sequence:CCGGGCCACTGTACAGGAGAAGTTTCTCGAGAAACTTCTCCTGTACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007401.1-2010s1c1
Sequence:CCGGGCGTTGATGATGGACATAAATCTCGAGATTTATGTCCATCATCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007401.2-1680s21c1
Sequence:CCGGTAGTCAAGATTGCACGGTAAACTCGAGTTTACCGTGCAATCTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007401.2-917s21c1
Sequence:CCGGTGTTACGCCAACGATTCATTACTCGAGTAATGAATCGTTGGCGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks