EMAIL THIS PAGE TO A FRIEND

ADAM8

ADAM metallopeptidase domain 8

70 Gene Product Result for
Synonyms: CD156 MS2
UniProtKB ID: P78325, B4DVM6, H0YL36, H0YLR0, H0YN39
Gene ID:
Human(101) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2009]
Mouse(11501) a disintegrin and metallopeptidase domain 8
Rat(499285) ADAM metallopeptidase domain 8
chicken(423672) ADAM metallopeptidase domain 8
dog(491699) ADAM metallopeptidase domain 8
cow(519652) ADAM metallopeptidase domain 8
domestic cat(101088880) ADAM metallopeptidase domain 8
domestic guinea pig(100726804) ADAM metallopeptidase domain 8
naked mole-rat(101701563) ADAM metallopeptidase domain 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1251 Human ADAM-8 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041171 MISSION® esiRNA esiRNA targeting mouse Adam8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109 Rosetta Predictions human pricing
XM_001056204 Rosetta Predictions rat pricing
XM_001056266 Rosetta Predictions rat pricing
XM_574584 Rosetta Predictions rat pricing
NM_007403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039615 predicted 737
2 SASI_Hs01_00039616 predicted 2062
3 SASI_Hs01_00039617 predicted 1670
4 SASI_Hs01_00039619 predicted 1770
5 SASI_Hs01_00039620 predicted 1659
6 SASI_Hs02_00324671 predicted 304
7 SASI_Hs01_00039621 predicted 1848
8 SASI_Hs01_00039622 predicted 1031
9 SASI_Hs02_00324672 predicted 716
10 SASI_Hs01_00039623 predicted 1818
11 SASI_Hs01_00039618 predicted 2013
12 SASI_Hs01_00039624 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282418 predicted 2007
2 SASI_Rn02_00282419 predicted 1110
3 SASI_Rn02_00282420 predicted 1614
4 SASI_Rn02_00282421 predicted 877
5 SASI_Rn02_00282422 predicted 814
6 SASI_Rn02_00282423 predicted 1885
7 SASI_Rn02_00282424 predicted 1654
8 SASI_Rn02_00282425 predicted 2566
9 SASI_Rn02_00282426 predicted 630
10 SASI_Rn02_00282427 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282705 predicted 1117
2 SASI_Rn02_00282706 predicted 1620
3 SASI_Rn02_00282707 predicted 884
4 SASI_Rn02_00282708 predicted 810
5 SASI_Rn02_00282709 predicted 1889
6 SASI_Rn02_00282710 predicted 1660
7 SASI_Rn02_00282711 predicted 2514
8 SASI_Rn02_00282712 predicted 633
9 SASI_Rn02_00282713 predicted 1721
10 SASI_Rn02_00282714 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402242 predicted 1850
2 SASI_Rn02_00402243 predicted 953
3 SASI_Rn02_00402244 predicted 1454
4 SASI_Rn02_00402245 predicted 723
5 SASI_Rn02_00402246 predicted 651
6 SASI_Rn02_00402247 predicted 1026
7 SASI_Rn02_00402248 predicted 1736
8 SASI_Rn02_00402249 predicted 1494
9 SASI_Rn02_00402250 predicted 478
10 SASI_Rn02_00402251 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151801 predicted 849
2 SASI_Mm01_00151802 predicted 846
3 SASI_Mm01_00151803 predicted 1757
4 SASI_Mm01_00151804 predicted 1861
5 SASI_Mm01_00151805 predicted 2307
6 SASI_Mm01_00151806 predicted 505
7 SASI_Mm01_00151807 predicted 1150
8 SASI_Mm01_00151808 predicted 960
9 SASI_Mm01_00151809 predicted 1938
10 SASI_Mm01_00151810 predicted 2529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109
ADAM8 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109.4-2867s21c1
Sequence:CCGGGTGTTCAGGAGGCCACATATACTCGAGTATATGTGGCCTCCTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109.4-2107s21c1
Sequence:CCGGGCATCATCGTCTACCGCAAAGCTCGAGCTTTGCGGTAGACGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001109.1-2602s1c1
Sequence:CCGGGCTGCTGTTCTAACCTCAGTACTCGAGTACTGAGGTTAGAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-1786s1c1
Sequence:CCGGCCAGAGAAGGTTTGCTGGAAACTCGAGTTTCCAGCAAACCTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-251s1c1
Sequence:CCGGCCGGCTACACAGAGACCTATACTCGAGTATAGGTCTCTGTGTAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-861s1c1
Sequence:CCGGGCATGACAACGTACAGCTCATCTCGAGATGAGCTGTACGTTGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-705s1c1
Sequence:CCGGCGTGGACAAGCTATATCAGAACTCGAGTTCTGATATAGCTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109
ADAM8 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109.4-2867s21c1
Sequence:CCGGGTGTTCAGGAGGCCACATATACTCGAGTATATGTGGCCTCCTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109.4-2107s21c1
Sequence:CCGGGCATCATCGTCTACCGCAAAGCTCGAGCTTTGCGGTAGACGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001109.1-2602s1c1
Sequence:CCGGGCTGCTGTTCTAACCTCAGTACTCGAGTACTGAGGTTAGAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-1786s1c1
Sequence:CCGGCCAGAGAAGGTTTGCTGGAAACTCGAGTTTCCAGCAAACCTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-251s1c1
Sequence:CCGGCCGGCTACACAGAGACCTATACTCGAGTATAGGTCTCTGTGTAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-861s1c1
Sequence:CCGGGCATGACAACGTACAGCTCATCTCGAGATGAGCTGTACGTTGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-705s1c1
Sequence:CCGGCGTGGACAAGCTATATCAGAACTCGAGTTCTGATATAGCTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109
ADAM8 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109.4-2867s21c1
Sequence:CCGGGTGTTCAGGAGGCCACATATACTCGAGTATATGTGGCCTCCTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109.4-2107s21c1
Sequence:CCGGGCATCATCGTCTACCGCAAAGCTCGAGCTTTGCGGTAGACGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001109.1-2602s1c1
Sequence:CCGGGCTGCTGTTCTAACCTCAGTACTCGAGTACTGAGGTTAGAACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-1786s1c1
Sequence:CCGGCCAGAGAAGGTTTGCTGGAAACTCGAGTTTCCAGCAAACCTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-251s1c1
Sequence:CCGGCCGGCTACACAGAGACCTATACTCGAGTATAGGTCTCTGTGTAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-861s1c1
Sequence:CCGGGCATGACAACGTACAGCTCATCTCGAGATGAGCTGTACGTTGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001109.1-705s1c1
Sequence:CCGGCGTGGACAAGCTATATCAGAACTCGAGTTCTGATATAGCTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007403
VALIDATED
ADAM8 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-1151s21c1
Sequence:CCGGCCTAGAGTCATTCGTGACAAACTCGAGTTTGTCACGAATGACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-542s21c3
Sequence:CCGGGCCTCGGGCATTAGAAATATACTCGAGTATATTTCTAATGCCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-1956s21c2
Sequence:CCGGGCAGATGTATCAGATGAACAACTCGAGTTGTTCATCTGATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-2303s21c1
Sequence:CCGGCCCAAAGATACCAAATCAGTTCTCGAGAACTGATTTGGTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-87s21c2
Sequence:CCGGGTGAAACAGTATGAAGTGGTTCTCGAGAACCACTTCATACTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-1151s1c1
Sequence:CCGGCCTAGAGTCATTCGTGACAAACTCGAGTTTGTCACGAATGACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-2303s1c1
Sequence:CCGGCCCAAAGATACCAAATCAGTTCTCGAGAACTGATTTGGTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007403.1-542s1c1
Sequence:CCGGGCCTCGGGCATTAGAAATATACTCGAGTATATTTCTAATGCCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-87s1c1
Sequence:CCGGGTGAAACAGTATGAAGTGGTTCTCGAGAACCACTTCATACTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-1956s1c1
Sequence:CCGGGCAGATGTATCAGATGAACAACTCGAGTTGTTCATCTGATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007403
VALIDATED
ADAM8 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-1151s21c1
Sequence:CCGGCCTAGAGTCATTCGTGACAAACTCGAGTTTGTCACGAATGACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-542s21c3
Sequence:CCGGGCCTCGGGCATTAGAAATATACTCGAGTATATTTCTAATGCCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-1956s21c2
Sequence:CCGGGCAGATGTATCAGATGAACAACTCGAGTTGTTCATCTGATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-2303s21c1
Sequence:CCGGCCCAAAGATACCAAATCAGTTCTCGAGAACTGATTTGGTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-87s21c2
Sequence:CCGGGTGAAACAGTATGAAGTGGTTCTCGAGAACCACTTCATACTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-1151s1c1
Sequence:CCGGCCTAGAGTCATTCGTGACAAACTCGAGTTTGTCACGAATGACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-2303s1c1
Sequence:CCGGCCCAAAGATACCAAATCAGTTCTCGAGAACTGATTTGGTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007403.1-542s1c1
Sequence:CCGGGCCTCGGGCATTAGAAATATACTCGAGTATATTTCTAATGCCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-87s1c1
Sequence:CCGGGTGAAACAGTATGAAGTGGTTCTCGAGAACCACTTCATACTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-1956s1c1
Sequence:CCGGGCAGATGTATCAGATGAACAACTCGAGTTGTTCATCTGATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007403
VALIDATED
ADAM8 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-1151s21c1
Sequence:CCGGCCTAGAGTCATTCGTGACAAACTCGAGTTTGTCACGAATGACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-542s21c3
Sequence:CCGGGCCTCGGGCATTAGAAATATACTCGAGTATATTTCTAATGCCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-1956s21c2
Sequence:CCGGGCAGATGTATCAGATGAACAACTCGAGTTGTTCATCTGATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-2303s21c1
Sequence:CCGGCCCAAAGATACCAAATCAGTTCTCGAGAACTGATTTGGTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007403.2-87s21c2
Sequence:CCGGGTGAAACAGTATGAAGTGGTTCTCGAGAACCACTTCATACTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-1151s1c1
Sequence:CCGGCCTAGAGTCATTCGTGACAAACTCGAGTTTGTCACGAATGACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-2303s1c1
Sequence:CCGGCCCAAAGATACCAAATCAGTTCTCGAGAACTGATTTGGTATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007403.1-542s1c1
Sequence:CCGGGCCTCGGGCATTAGAAATATACTCGAGTATATTTCTAATGCCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-87s1c1
Sequence:CCGGGTGAAACAGTATGAAGTGGTTCTCGAGAACCACTTCATACTGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007403.1-1956s1c1
Sequence:CCGGGCAGATGTATCAGATGAACAACTCGAGTTGTTCATCTGATACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks