EMAIL THIS PAGE TO A FRIEND

ADAM9

ADAM metallopeptidase domain 9

199 Gene Product Result for
Synonyms: CORD9 MCMP MDC9 Mltng
UniProtKB ID: Q13443, B7ZLN7, Q10718, Q8NFM6
Gene ID:
Human(8754) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
Mouse(11502) a disintegrin and metallopeptidase domain 9 (meltrin gamma)
Rat(290834) ADAM metallopeptidase domain 9
Zebrafish(447940) a disintegrin and metalloproteinase domain 9
chicken(426781) ADAM metallopeptidase domain 9
dog(475579) ADAM metallopeptidase domain 9
domestic cat(101084619) ADAM metallopeptidase domain 9
Horse(100058578) ADAM metallopeptidase domain 9
cow(281600) ADAM metallopeptidase domain 9
naked mole-rat(101725832) ADAM metallopeptidase domain 9
domestic guinea pig(100727737) ADAM metallopeptidase domain 9
sheep(101115001) ADAM metallopeptidase domain 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003816 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005845 Rosetta Predictions human pricing
NM_003816 Rosetta Predictions human pricing
NM_001014772 Rosetta Predictions rat pricing
NM_007404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112373 predicted 1133
2 SASI_Hs01_00112375 predicted 1648
3 SASI_Hs02_00305027 predicted 1482
4 SASI_Hs01_00112377 predicted 1801
5 SASI_Hs01_00112378 predicted 396
6 SASI_Hs01_00112379 predicted 1015
7 SASI_Hs01_00112380 predicted 1435
8 SASI_Hs01_00112381 predicted 712
9 SASI_Hs01_00112382 predicted 800
10 SASI_Hs02_00305028 predicted 1578
11 SASI_Hs01_00112374 predicted 1632
12 SASI_Hs01_00112376 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224626 predicted 1140
2 SASI_Hs01_00224628 predicted 1641
3 SASI_Hs02_00336358 predicted 1479
4 SASI_Hs01_00224630 predicted 1801
5 SASI_Hs01_00224631 predicted 395
6 SASI_Hs01_00224632 predicted 1020
7 SASI_Hs01_00224633 predicted 1444
8 SASI_Hs01_00224634 predicted 710
9 SASI_Hs01_00224635 predicted 808
10 SASI_Hs02_00336359 predicted 1582
11 SASI_Hs01_00224627 predicted 1632
12 SASI_Hs01_00224629 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201852 predicted 609
2 SASI_Rn02_00201853 predicted 817
3 SASI_Rn02_00201854 predicted 430
4 SASI_Rn02_00201855 predicted 1059
5 SASI_Rn02_00201856 predicted 492
6 SASI_Rn02_00201857 predicted 389
7 SASI_Rn02_00201858 predicted 1185
8 SASI_Rn02_00201859 predicted 760
9 SASI_Rn02_00201860 predicted 1941
10 SASI_Rn02_00201861 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311522 predicted 1163
2 SASI_Mm02_00311523 predicted 970
3 SASI_Mm02_00311524 predicted 771
4 SASI_Mm02_00311525 predicted 871
5 SASI_Mm02_00311526 predicted 899
6 SASI_Mm02_00311527 predicted 2059
7 SASI_Mm02_00311528 predicted 742
8 SASI_Mm02_00311529 predicted 1203
9 SASI_Mm02_00311530 predicted 1455
10 SASI_Mm02_00311531 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007404
VALIDATED
ADAM9 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-155s1c1
Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-477s1c1
Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-1930s1c1
Sequence:CCGGCCTGAATTATGACTGTGACATCTCGAGATGTCACAGTCATAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-1335s1c1
Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-735s1c1
Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-283s21c1
Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-1463s21c1
Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-863s21c1
Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-605s21c1
Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007404
VALIDATED
ADAM9 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-155s1c1
Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-477s1c1
Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-1930s1c1
Sequence:CCGGCCTGAATTATGACTGTGACATCTCGAGATGTCACAGTCATAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-1335s1c1
Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-735s1c1
Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-283s21c1
Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-1463s21c1
Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-863s21c1
Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-605s21c1
Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007404
VALIDATED
ADAM9 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-155s1c1
Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-477s1c1
Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-1930s1c1
Sequence:CCGGCCTGAATTATGACTGTGACATCTCGAGATGTCACAGTCATAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-1335s1c1
Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007404.1-735s1c1
Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-283s21c1
Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-1463s21c1
Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-863s21c1
Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007404.2-605s21c1
Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003816
VALIDATED
ADAM9 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-1628s1c1
Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-984s1c1
Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-1592s1c1
Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-2365s1c1
Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-568s1c1
Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-2365s21c1
Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-1628s21c1
Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-568s21c1
Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-1592s21c1
Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-984s21c1
Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003816
VALIDATED
ADAM9 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-1628s1c1
Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-984s1c1
Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-1592s1c1
Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-2365s1c1
Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-568s1c1
Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-2365s21c1
Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-1628s21c1
Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-568s21c1
Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-1592s21c1
Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-984s21c1
Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003816
VALIDATED
ADAM9 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-1628s1c1
Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-984s1c1
Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-1592s1c1
Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-2365s1c1
Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003816.1-568s1c1
Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-2365s21c1
Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-1628s21c1
Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-568s21c1
Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-1592s21c1
Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003816.2-984s21c1
Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks